GET /api/target/
HTTP 200 OK
Allow: GET
Content-Type: application/json
Vary: Accept

[
    {
        "name": "ALDOB enhancer",
        "reference_sequence": {
            "sequence": "TCTTCAATCTGGGTATGCTGACTCAACCAGAATAACAGTGAAAATGATAATTCAAACTAATACTGTTTACAGGGAGTTAAACTTCTACAGTGGGATTAAAGGTCTGTACCACGTTAGCACAAATGTCACCTCTCTGTTAATCATAAAACAGGGTCACAGGCCAATGTTCACCACAAGGAGACAGGAGGACAACCTGGGATGGGTAATGACAAAGAACGATTTCCGTACTCCTAAGCCTCTGCTCTCTCAGATCTCAAGC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg19",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.13",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000006-a-1",
        "type": "Regulatory"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-j-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-g-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-e-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-l-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-a-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-h-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-k-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-f-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-i-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-d-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-b-1",
        "type": "Protein coding"
    },
    {
        "name": "alpha-synuclein",
        "reference_sequence": {
            "sequence": "ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P37840",
            "url": "http://purl.uniprot.org/uniprot/P37840",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000045-c-1",
        "type": "Protein coding"
    },
    {
        "name": "Aβ42",
        "reference_sequence": {
            "sequence": "GATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 670,
            "identifier": "P05067",
            "url": "http://purl.uniprot.org/uniprot/P05067",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000058-a-1",
        "type": "Protein coding"
    },
    {
        "name": "BCL11A enhancer",
        "reference_sequence": {
            "sequence": "CCTAACACAGTAGCTGGTACCTGATAGGTGCCTATATGTGATGGATGGGTGGACAGCCCGACAGATGAAAAATGGACAATTATGAGGAGGGGAGAGTGCAGACAGGGGAAGCTTCACCTCCTTTACAATTTTGGGAGTCCACACGGCATGGCATACAAATTATTTCATTCCCATTGAGAAATAAAATCCAATTCTCCATCACCAAGAGAGCCTTCCGAAAGAGGCCCCCCTGGGCAAACGGCCACCGATGGAGAGGTCTGCCAGTCCTCTTCTACCCCACCCACGCCCCCACCCTAATCAGAGGCCAAACCCTTCCTGGAGCCTGTGATAAAAGCAACTGTTAGCTTGCACTAGACTAGCTTCAAAGTTGTATTGACCCTGGTGTGTTATGTCTAAGAGTAGATGCCATATCTCTTTTCTGGCCTATGTTATTACCTGTATGGACTTTGCACTGGAATCAGCTATCTGCTCTTACTTATGCACACCTGGGGCATAGAGCCAGCCCTGTATCGCTTTTCAGCCATCTCACTACAGATAACTCCCAAGTCCTGTCTAGCTGCCTTCCTTATCACAGGAATAGCACCCAAGGTCCATCAGTAC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000014-a-1",
        "type": "Regulatory"
    },
    {
        "name": "BRCA1 RING domain",
        "reference_sequence": {
            "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAGGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAGTTC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000003-b-2",
        "type": "Protein coding"
    },
    {
        "name": "BRCA1 RING domain",
        "reference_sequence": {
            "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAGGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAGTTC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000003-a-1",
        "type": "Protein coding"
    },
    {
        "name": "BRCA1 RING domain",
        "reference_sequence": {
            "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAGGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAGTTC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000003-b-1",
        "type": "Protein coding"
    },
    {
        "name": "BRCA1 RING domain",
        "reference_sequence": {
            "sequence": "GATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGCCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAGGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAGTTC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000003-a-2",
        "type": "Protein coding"
    },
    {
        "name": "CALM1",
        "reference_sequence": {
            "sequence": "ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P0DP23",
            "url": "http://purl.uniprot.org/uniprot/P0DP23",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000198668",
            "url": "http://www.ensembl.org/id/ENSG00000198668",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 833,
            "identifier": "NM_001363670.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001363670.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-c-1",
        "type": "Protein coding"
    },
    {
        "name": "CALM1",
        "reference_sequence": {
            "sequence": "ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P0DP23",
            "url": "http://purl.uniprot.org/uniprot/P0DP23",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000198668",
            "url": "http://www.ensembl.org/id/ENSG00000198668",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 833,
            "identifier": "NM_001363670.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001363670.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-c-2",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-4",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-2",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-3",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-5",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-6",
        "type": "Protein coding"
    },
    {
        "name": "CBS",
        "reference_sequence": {
            "sequence": "ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAGCCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATTCTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGACCGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTGAGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTGGATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTGGACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCCGCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAGGACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAGAAGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGCAAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGCACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P35520",
            "url": "http://purl.uniprot.org/uniprot/P35520",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000160200",
            "url": "http://www.ensembl.org/id/ENSG00000160200",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000005-a-1",
        "type": "Protein coding"
    },
    {
        "name": "CCR5",
        "reference_sequence": {
            "sequence": "GATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P51681",
            "url": "http://purl.uniprot.org/uniprot/P51681",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000047-b-1",
        "type": "Protein coding"
    },
    {
        "name": "CCR5",
        "reference_sequence": {
            "sequence": "GATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P51681",
            "url": "http://purl.uniprot.org/uniprot/P51681",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000047-a-1",
        "type": "Protein coding"
    },
    {
        "name": "CCR5",
        "reference_sequence": {
            "sequence": "GATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P51681",
            "url": "http://purl.uniprot.org/uniprot/P51681",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000047-c-1",
        "type": "Protein coding"
    },
    {
        "name": "CD86",
        "reference_sequence": {
            "sequence": "GACCACATTCCTTGGATTACAGCTGTACTTCCAACAGTTATTATATGTGTGATGGTTTTCTGTCTAATTCTATGGAAATGG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 243,
            "identifier": "P42081",
            "url": "http://purl.uniprot.org/uniprot/P42081",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000046-a-2",
        "type": "Protein coding"
    },
    {
        "name": "CD86",
        "reference_sequence": {
            "sequence": "GACCACATTCCTTGGATTACAGCTGTACTTCCAACAGTTATTATATGTGTGATGGTTTTCTGTCTAATTCTATGGAAATGG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 243,
            "identifier": "P42081",
            "url": "http://purl.uniprot.org/uniprot/P42081",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000046-a-3",
        "type": "Protein coding"
    },
    {
        "name": "CD86",
        "reference_sequence": {
            "sequence": "GACCACATTCCTTGGATTACAGCTGTACTTCCAACAGTTATTATATGTGTGATGGTTTTCTGTCTAATTCTATGGAAATGG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 243,
            "identifier": "P42081",
            "url": "http://purl.uniprot.org/uniprot/P42081",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000046-a-1",
        "type": "Protein coding"
    },
    {
        "name": "CXCR4",
        "reference_sequence": {
            "sequence": "GAGGGGATCAGTATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P61073",
            "url": "http://purl.uniprot.org/uniprot/P61073",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000048-c-1",
        "type": "Protein coding"
    },
    {
        "name": "CXCR4",
        "reference_sequence": {
            "sequence": "GAGGGGATCAGTATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P61073",
            "url": "http://purl.uniprot.org/uniprot/P61073",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000048-a-1",
        "type": "Protein coding"
    },
    {
        "name": "CXCR4",
        "reference_sequence": {
            "sequence": "GAGGGGATCAGTATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P61073",
            "url": "http://purl.uniprot.org/uniprot/P61073",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000048-b-1",
        "type": "Protein coding"
    },
    {
        "name": "CYP2C19",
        "reference_sequence": {
            "sequence": "CTCTGTCTCTCATGTTTGCTTCTCCTTTCAATCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGATATTAAGGATGTCAGCAAATCCTTAACCAATCTCTCAAAAATCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGGAACGCATGGTGGTGCTGCATGGATATGAAGTGGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCCATTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATCGTTTTCAGCAATGGAAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCTTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCAGAAACGTTTCGATTATAAAGATCAGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGGATCCAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCGGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGACATCAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGGAAAAGCAAAACCAACAGTCTGAATTCACTATTGAAAACTTGGTAATCACTGCAGCTGACTTACTTGGAGCTGGGACAGAGACAACAAGCACAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGATTGAACGTGTCATTGGCAGAAACCGGAGCCCCTGCATGCAGGACAGGGGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATCGACCTCATCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACGTTAAATTCAGAAACTACCTCATTCCCAAGGGCACAACCATATTAACTTCCCTCACTTCTGTGCTACATGACAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCGTCACTTTCTGGATGAAGGTGGAAATTTTAAGAAAAGTAACTACTTCATGCCTTTCTCAGCAGGAAAACGGATTTGTGTGGGAGAGGGCCTGGCCCGCATGGAGCTGTTTTTATTCCTGACCTTCATTTTACAGAACTTTAACCTGAAATCTCTGATTGACCCAAAGGACCTTGACACAACTCCTGTTGTCAATGGATTTGCTTCTGTCCCGCCCTTCTATCAGCTGTGCTTCATTCCT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 8,
            "identifier": "P33261",
            "url": "http://purl.uniprot.org/uniprot/P33261",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000062-b-1",
        "type": "Protein coding"
    },
    {
        "name": "CYP2C9",
        "reference_sequence": {
            "sequence": "TCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAAGGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCATTTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAAATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCCTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCATAAACGTTTTGATTATAAAGATCAGCAATTTCTTAACTTAATGGAAAAGTTGAATGAAAACATCAAGATTTTGAGCAGCCCCTGGATCCAGATCTGCAATAATTTTTCTCCTATCATTGATTACTTCCCGGGAACTCACAACAAATTACTTAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAACACCAAGAATCAATGGACATGAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAGAAGGAAAAGCACAACCAACCATCTGAATTTACTATTGAAAGCTTGGAAAACACTGCAGTTGACTTGTTTGGAGCTGGGACAGAGACGACAAGCACAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGGCACAACCATATTAATTTCCCTGACTTCTGTGCTACATGACAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCATCACTTTCTGGATGAAGGTGGCAATTTTAAGAAAAGTAAATACTTCATGCCTTTCTCAGCAGGAAAACGGATTTGTGTGGGAGAAGCCCTGGCCGGCATGGAGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCTTGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 2,
            "identifier": "P11712",
            "url": "http://purl.uniprot.org/uniprot/P11712",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000062-a-1",
        "type": "Protein coding"
    },
    {
        "name": "DHFR",
        "reference_sequence": {
            "sequence": "ATGATCAGTCTGATTGCGGCGTTAGCGGTAGATCGCGTTATCGGCATGGAAAACGCCATGCCGTGGAACCTGCCTGCCGATCTCGCCTGGTTTAAACGCAACACCTTAAATAAACCCGTGATTATGGGCCGCCATACCTGGGAATCAATCGGTCGTCCGTTGCCAGGACGCAAAAATATTATCCTCAGCAGTCAACCGGGTACGGACGATCGCGTAACGTGGGTGAAGTCGGTGGATGAAGCCATCGCGGCGTGTGGTGACGTACCAGAAATCATGGTGATTGGCGGCGGTCGCGTTTATGAACAGTTCTTGCCAAAAGCGCAAAAACTGTATCTGACGCATATCGACGCAGAAGTGGAAGGCGACACCCATTTCCCGGATTACGAGCCGGATGACTGGGAATCGGTATTCAGCGAATTCCACGATGCTGATGCGCAGAACTCTCACAGCTATTGCTTTGAGATTCTGGAGCGGCGGTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P0ABQ4",
            "url": "http://purl.uniprot.org/uniprot/P0ABQ4",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000063-a-1",
        "type": "Protein coding"
    },
    {
        "name": "DHFR",
        "reference_sequence": {
            "sequence": "ATGATCAGTCTGATTGCGGCGTTAGCGGTAGATCGCGTTATCGGCATGGAAAACGCCATGCCGTGGAACCTGCCTGCCGATCTCGCCTGGTTTAAACGCAACACCTTAAATAAACCCGTGATTATGGGCCGCCATACCTGGGAATCAATCGGTCGTCCGTTGCCAGGACGCAAAAATATTATCCTCAGCAGTCAACCGGGTACGGACGATCGCGTAACGTGGGTGAAGTCGGTGGATGAAGCCATCGCGGCGTGTGGTGACGTACCAGAAATCATGGTGATTGGCGGCGGTCGCGTTTATGAACAGTTCTTGCCAAAAGCGCAAAAACTGTATCTGACGCATATCGACGCAGAAGTGGAAGGCGACACCCATTTCCCGGATTACGAGCCGGATGACTGGGAATCGGTATTCAGCGAATTCCACGATGCTGATGCGCAGAACTCTCACAGCTATTGCTTTGAGATTCTGGAGCGGCGGTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P0ABQ4",
            "url": "http://purl.uniprot.org/uniprot/P0ABQ4",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000063-b-1",
        "type": "Protein coding"
    },
    {
        "name": "E4B",
        "reference_sequence": {
            "sequence": "ATAGAGAAGTTTAAACTTCTTGCAGAGAAAGTGGAGGAAATCGTGGCAAAGAATGCGCGGGCAGAAATAGACTACAGCGATGCCCCGGACGAGTTCAGAGACCCTCTGATGGACACCCTGATGACCGATCCCGTGAGACTGCCCTCTGGCACCGTCATGGACCGTTCTATCATCCTGCGGCATCTGCTCAACTCCCCCACCGACCCCTTCAACCGCCAGATGCTGACTGAGAGCATGCTGGAGCCAGTGCCAGAGCTAAAGGAGCAGATTCAGGCCTGGATGAGAGAGAAACAGAGCAGTGACCACTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1071,
            "identifier": "Q9ES00",
            "url": "http://purl.uniprot.org/uniprot/Q9ES00",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": {
            "offset": 3939,
            "identifier": "NM_022022.3",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_022022.3",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "mm10",
                    "organism_name": "Mus musculus",
                    "assembly_identifier": {
                        "identifier": "GCF_000001635.20",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000004-a-1",
        "type": "Protein coding"
    },
    {
        "name": "E4B",
        "reference_sequence": {
            "sequence": "ATAGAGAAGTTTAAACTTCTTGCAGAGAAAGTGGAGGAAATCGTGGCAAAGAATGCGCGGGCAGAAATAGACTACAGCGATGCCCCGGACGAGTTCAGAGACCCTCTGATGGACACCCTGATGACCGATCCCGTGAGACTGCCCTCTGGCACCGTCATGGACCGTTCTATCATCCTGCGGCATCTGCTCAACTCCCCCACCGACCCCTTCAACCGCCAGATGCTGACTGAGAGCATGCTGGAGCCAGTGCCAGAGCTAAAGGAGCAGATTCAGGCCTGGATGAGAGAGAAACAGAGCAGTGACCACTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1071,
            "identifier": "Q9ES00",
            "url": "http://purl.uniprot.org/uniprot/Q9ES00",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": {
            "offset": 3939,
            "identifier": "NM_022022.3",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_022022.3",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "mm10",
                    "organism_name": "Mus musculus",
                    "assembly_identifier": {
                        "identifier": "GCF_000001635.20",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000004-a-3",
        "type": "Protein coding"
    },
    {
        "name": "E4B",
        "reference_sequence": {
            "sequence": "ATAGAGAAGTTTAAACTTCTTGCAGAGAAAGTGGAGGAAATCGTGGCAAAGAATGCGCGGGCAGAAATAGACTACAGCGATGCCCCGGACGAGTTCAGAGACCCTCTGATGGACACCCTGATGACCGATCCCGTGAGACTGCCCTCTGGCACCGTCATGGACCGTTCTATCATCCTGCGGCATCTGCTCAACTCCCCCACCGACCCCTTCAACCGCCAGATGCTGACTGAGAGCATGCTGGAGCCAGTGCCAGAGCTAAAGGAGCAGATTCAGGCCTGGATGAGAGAGAAACAGAGCAGTGACCACTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1071,
            "identifier": "Q9ES00",
            "url": "http://purl.uniprot.org/uniprot/Q9ES00",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": {
            "offset": 3939,
            "identifier": "NM_022022.3",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_022022.3",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "mm10",
                    "organism_name": "Mus musculus",
                    "assembly_identifier": {
                        "identifier": "GCF_000001635.20",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.20",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000004-a-2",
        "type": "Protein coding"
    },
    {
        "name": "ECR11 enhancer",
        "reference_sequence": {
            "sequence": "CTCTGAAGCTCAAAAGCAATGATTTGATAAGGCTTCGATTTTTAACACTTGAATTCCAACACCTTTAAAAATACTAAATGTTTCCCATTTTAAACAAGCCAAGTGAATGACTGAATTCTTAACCAAAAATAAATGTGAAGTAGATTGATATCACTCTTTGTCCATACAGAACATTATATAAATATTCTCTGGCCTTACTATCTAGCAAGGCAGGAAAAATAGATCAATTTGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACATGGACACAGGAAGGGGAACATCACACATCGGGGCCTGTTGTGGGGTGGGGGGAGGGGGGAGGGATAGCATTAGGAGATATATCTAACGTTAAATGACGTGTTAATGGGAGCAGCACACCAACATGGCACATGTATACATATGTAACAAACTGCATGTTGTGCACATGTACCCTAAAACTTAAAGTATAATAAGAAAAATAGATCAATTTACTCTACATCTGAGATTAAAAAGCAGAAAGACTCACTCACAGAGTTTCAGTATTTGACATTCAGAACCAGAAATAGAGTAACAGCGAGAACTTGAACTATTTCAGTTTAGCCTCCCACCCTCTCTGCTATCACTTCCCAAAA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg19",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.13",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000007-a-1",
        "type": "Regulatory"
    },
    {
        "name": "EGFP",
        "reference_sequence": {
            "sequence": "ATG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "C5MKY7",
            "url": "http://purl.uniprot.org/uniprot/C5MKY7",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000042-a-1",
        "type": "Protein coding"
    },
    {
        "name": "ErbB2",
        "reference_sequence": {
            "sequence": "CTGACGTCTATCATCTCTGCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGCGTGGTCTTTGGCATCCTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 650,
            "identifier": "P04626",
            "url": "http://purl.uniprot.org/uniprot/P04626",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000051-b-1",
        "type": "Protein coding"
    },
    {
        "name": "F9 promoter",
        "reference_sequence": {
            "sequence": "GTCCCACTGATGAACTGTGCTGCCACAGTAAATGTAGCCACTATGCCTATCTCCATTCTGAAGATGTGTCACTTCCTGTTTCAGACTCAAATCAGCCACAGTGGCAGAAGCCCACGAAATCAGAGGTGAAATTTAATAATGACCACTGCCCATTCTCTTCACTTGTCCCAAGAGGCCATTGGAAATAGTCCAAAGACCCATTGAGGGAGATGGACATTATTTCCCAGAAGTAAATACAGCTCAGCTTGTACTTTGGTACAACTAATCGACCTTACCACTTTCACAATCTGCTAGCAAAGGTTA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000015-a-1",
        "type": "Regulatory"
    },
    {
        "name": "FOXE1 promoter",
        "reference_sequence": {
            "sequence": "CTCGCCAGCGGTCCGCAGGGCTGGAGACCCACGCCGTGGAGAGGACCAGCCTCAGGTCGCCCCGCCTGGGCCCGCGCCCCGACCTCGCTGCCCCCGCCTCGCCTCTCTGCCCGTGGCGCTTACGGCCACCTTGGCCTCGGGGGCAGGGCATGGGCGGCCCCCGCCAGATCGCCCAGCGCCAGTACTAACTGCCCTCGCTCTGGCCTTCGAGCCCGAAGCCTCTTCTGCGCGCACAACCTAGGCAGTAATCCTAAACTAGCGGGCACCACAGACCAGCTGCAGCCACCCCAACCCAGGGATCACTTCCGGACCCCTCGACCGCCCGGCACCAGCGCGCAAGGGACCCTTCAGCCGGAGACCAGAGTCCAGTCCCGGTCACGAGGCCACCGCCGCTGCCCGCCTCGAGAAGCACCACGCGGGCTGAGCCGTCGGCTAGCGGGTCACTCCCGAGCCTCTGTCTGCACCGCGCCAGCCCCAGACCACGGACGCTGAGCCTCCAGCGCGTGCCAGCCTGGGCCGCTGGGCTCTCGGGGCCAGCCCGCGACGATCCCCTGAGCTCTCCGCAGAAGGGCCGAGCGTCCGTTCCGGGGACGCCAGGCC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000016-a-1",
        "type": "Regulatory"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-1",
        "type": "Protein coding"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-5",
        "type": "Protein coding"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-4",
        "type": "Protein coding"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-3",
        "type": "Protein coding"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-2",
        "type": "Protein coding"
    },
    {
        "name": "Gal4",
        "reference_sequence": {
            "sequence": "AAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCTACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCAAGGCTAGAAAGACTGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P04386",
            "url": "http://purl.uniprot.org/uniprot/P04386",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000012-a-6",
        "type": "Protein coding"
    },
    {
        "name": "Gcn4",
        "reference_sequence": {
            "sequence": "AGCACTGATTCAACTCCAATGTTTGAGTATGAAAACCTAGAAGACAACTCTAAAGAATGGACATCCTTGTTTGACAATGACATTCCAGTTACCACTGACGATGTTTCATTGGCTGATAAGGCAATTGAATCC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 100,
            "identifier": "P03069",
            "url": "http://purl.uniprot.org/uniprot/P03069",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000052-a-1",
        "type": "Protein coding"
    },
    {
        "name": "Gcn4",
        "reference_sequence": {
            "sequence": "AGCACTGATTCAACTCCAATGTTTGAGTATGAAAACCTAGAAGACAACTCTAAAGAATGGACATCCTTGTTTGACAATGACATTCCAGTTACCACTGACGATGTTTCATTGGCTGATAAGGCAATTGAATCC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 100,
            "identifier": "P03069",
            "url": "http://purl.uniprot.org/uniprot/P03069",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000052-b-1",
        "type": "Protein coding"
    },
    {
        "name": "Glycophorin A",
        "reference_sequence": {
            "sequence": "CTCATTATTTTTGGGGTGATGGCTGGTGTTATTGGAACGATCCTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 93,
            "identifier": "P02724",
            "url": "http://purl.uniprot.org/uniprot/P02724",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000051-c-1",
        "type": "Protein coding"
    },
    {
        "name": "GP1BB promoter",
        "reference_sequence": {
            "sequence": "GTTGTGAATGCCGCGTCCTGTCCTGGTGACAGGAGAACAATGTTGGTGAACGTCGCAGCGGGTGTCCGAGTGCTCCGTGTGCCCCTGAGAGCGGGTGGGAGCGGAAGCCTGAGCGGCCTGCGGCCTCCGGCGATAGTGTGCTATCTGCCGCTGCAGCGCGCGTCCGCGCGGCCTCTGGGCTATTTCTGGCCAGGCCGCAGCACTGTGGTCGGTGCGGGCGTGGCAGGGGCGGGGCGGCCTTATCGCTCGGCTCTCCCGCCTACGCCTCCCGCTGCAGAGTAAGCCGGGCTGCCGTCTTCTCGCCATGGGCTCCGGTGAGTCTGGAGTCCGGTCGGGCCCCCGGCTGCTCCCTAGGCCGACCCGGGTTGAGAGGAGCTCTGGTCGT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000017-a-1",
        "type": "Regulatory"
    },
    {
        "name": "HBB promoter",
        "reference_sequence": {
            "sequence": "GGTGTCTGTTTGAGGTTGCTAGTGAACACAGTTGTGTCAGAAGCAAATGTAAGCAATAGATGGCTCTGCCCTGACTTTTATGCCCAGCCCTGGCTCCTGCCCTCCCTGCTCCTGGGAGTAGATTGGCCAACCCTAGGGTGTGGCTCCACAGGGTGAGGTCTAAGTGATGACAGCCGTACCTGTCCTT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000018-a-1",
        "type": "Regulatory"
    },
    {
        "name": "HBG1 promoter",
        "reference_sequence": {
            "sequence": "GGCGTCTGGACTAGGAGCTTATTGATAACCTCAGACGTTCCAGAAGCGAGTGTGTGGAACTGCTGAAGGGTGCTTCCTTTTATTCTTCATCCCTAGCCAGCCGCCGGCCCCTGGCCTCACTGGATACTCTAAGACTATTGGTCAAGTTTGCCTTGTCAAGGCTATTGGTCAAGGCAAGGCTGGCCAACCCATGGGTGGAGTTTAGCCAGGGACCGTTTCAGACAGATATTTGCATTGAGATAGTGTGGGGAAGGGGCCCCCAAGAGGATACTGC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000019-a-1",
        "type": "Regulatory"
    },
    {
        "name": "HMGCR",
        "reference_sequence": {
            "sequence": "ATGTTGTCAAGACTTTTTCGAATGCATGGCCTCTTTGTGGCCTCCCATCCCTGGGAAGTCATAGTGGGGACAGTGACACTGACCATCTGCATGATGTCCATGAACATGTTTACTGGTAACAATAAGATCTGTGGTTGGAATTATGAATGTCCAAAGTTTGAAGAGGATGTTTTGAGCAGTGACATTATAATTCTGACAATAACACGATGCATAGCCATCCTGTATATTTACTTCCAGTTCCAGAATTTACGTCAACTTGGATCAAAATATATTTTGGGTATTGCTGGCCTTTTCACAATTTTCTCAAGTTTTGTATTCAGTACAGTTGTCATTCACTTCTTAGACAAAGAATTGACAGGCTTGAATGAAGCTTTGCCCTTTTTCCTACTTTTGATTGACCTTTCCAGAGCAAGCACATTAGCAAAGTTTGCCCTCAGTTCCAACTCACAGGATGAAGTAAGGGAAAATATTGCTCGTGGAATGGCAATTTTAGGTCCTACGTTTACCCTCGATGCTCTTGTTGAATGTCTTGTGATTGGAGTTGGTACCATGTCAGGGGTACGTCAGCTTGAAATTATGTGCTGCTTTGGCTGCATGTCAGTTCTTGCCAACTACTTCGTGTTCATGACTTTCTTCCCAGCTTGTGTGTCCTTGGTATTAGAGCTTTCTCGGGAAAGCCGCGAGGGTCGTCCAATTTGGCAGCTCAGCCATTTTGCCCGAGTTTTAGAAGAAGAAGAAAATAAGCCGAATCCTGTAACTCAGAGGGTCAAGATGATTATGTCTCTAGGCTTGGTTCTTGTTCATGCTCACAGTCGCTGGATAGCTGATCCTTCTCCTCAAAACAGTACAGCAGATACTTCTAAGGTTTCATTAGGACTGGATGAAAATGTGTCCAAGAGAATTGAACCAAGTGTTTCCCTCTGGCAGTTTTATCTCTCTAAAATGATCAGCATGGATATTGAACAAGTTATTACCCTAAGTTTAGCTCTCCTTCTGGCTGTCAAGTACATCTTCTTTGAACAAACAGAGACAGAATCTACACTCTCATTAAAAAACCCTATCACATCTCCTGTAGTGACACAAAAGAAAGTCCCAGACAATTGTTGTAGACGTGAACCTATGCTGGTCAGAAATAACCAGAAATGTGATTCAGTAGAGGAAGAGACAGGGATAAACCGAGAAAGAAAAGTTGAGGTTATAAAACCCTTAGTGGCTGAAACAGATACCCCAAACAGAGCTACATTTGTGGTTGGTAACTCCTCCTTACTCGATACTTCATCAGTACTGGTGACACAGGAACCTGAAATTGAACTTCCCAGGGAACCTCGGCCTAATGAAGAATGTCTACAGATACTTGGGAATGCAGAGAAAGGTGCAAAATTCCTTAGTGATGCTGAGATCATCCAGTTAGTCAATGCTAAGCATATCCCAGCCTACAAGTTGGAAACTCTGATGGAAACTCATGAGCGTGGTGTATCTATTCGCCGACAGTTACTTTCCAAGAAGCTTTCAGAACCTTCTTCTCTCCAGTACCTACCTTACAGGGATTATAATTACTCCTTGGTGATGGGAGCTTGTTGTGAGAATGTTATTGGATATATGCCCATCCCTGTTGGAGTGGCAGGACCCCTTTGCTTAGATGAAAAAGAATTTCAGGTTCCAATGGCAACAACAGAAGGTTGTCTTGTGGCCAGCACCAATAGAGGCTGCAGAGCAATAGGTCTTGGTGGAGGTGCCAGCAGCCGAGTCCTTGCAGATGGGATGACTCGTGGCCCAGTTGTGCGTCTTCCACGTGCTTGTGACTCTGCAGAAGTGAAAGCCTGGCTCGAAACATCTGAAGGGTTCGCAGTGATAAAGGAGGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGATGCAGCACAGAATGTTGGTAGTTCAAACTGTATTACTTTAATGGAAGCAAGTGGTCCCACAAATGAAGATTTATATATCAGCTGCACCATGCCATCTATAGAGATAGGAACGGTGGGTGGTGGGACCAACCTACTACCTCAGCAAGCCTGTTTGCAGATGCTAGGTGTTCAAGGAGCATGCAAAGATAATCCTGGGGAAAATGCCCGGCAGCTTGCCCGAATTGTGTGTGGGACCGTAATGGCTGGGGAATTGTCACTTATGGCAGCATTGGCAGCAGGACATCTTGTCAAAAGTCACATGATTCACAACAGGTCGAAGATCAATTTACAAGACCTCCAAGGAGCTTGCACCAAGAAGACAGCCTGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000035-a-1",
        "type": "Protein coding"
    },
    {
        "name": "HMGCR",
        "reference_sequence": {
            "sequence": "ATGTTGTCAAGACTTTTTCGAATGCATGGCCTCTTTGTGGCCTCCCATCCCTGGGAAGTCATAGTGGGGACAGTGACACTGACCATCTGCATGATGTCCATGAACATGTTTACTGGTAACAATAAGATCTGTGGTTGGAATTATGAATGTCCAAAGTTTGAAGAGGATGTTTTGAGCAGTGACATTATAATTCTGACAATAACACGATGCATAGCCATCCTGTATATTTACTTCCAGTTCCAGAATTTACGTCAACTTGGATCAAAATATATTTTGGGTATTGCTGGCCTTTTCACAATTTTCTCAAGTTTTGTATTCAGTACAGTTGTCATTCACTTCTTAGACAAAGAATTGACAGGCTTGAATGAAGCTTTGCCCTTTTTCCTACTTTTGATTGACCTTTCCAGAGCAAGCACATTAGCAAAGTTTGCCCTCAGTTCCAACTCACAGGATGAAGTAAGGGAAAATATTGCTCGTGGAATGGCAATTTTAGGTCCTACGTTTACCCTCGATGCTCTTGTTGAATGTCTTGTGATTGGAGTTGGTACCATGTCAGGGGTACGTCAGCTTGAAATTATGTGCTGCTTTGGCTGCATGTCAGTTCTTGCCAACTACTTCGTGTTCATGACTTTCTTCCCAGCTTGTGTGTCCTTGGTATTAGAGCTTTCTCGGGAAAGCCGCGAGGGTCGTCCAATTTGGCAGCTCAGCCATTTTGCCCGAGTTTTAGAAGAAGAAGAAAATAAGCCGAATCCTGTAACTCAGAGGGTCAAGATGATTATGTCTCTAGGCTTGGTTCTTGTTCATGCTCACAGTCGCTGGATAGCTGATCCTTCTCCTCAAAACAGTACAGCAGATACTTCTAAGGTTTCATTAGGACTGGATGAAAATGTGTCCAAGAGAATTGAACCAAGTGTTTCCCTCTGGCAGTTTTATCTCTCTAAAATGATCAGCATGGATATTGAACAAGTTATTACCCTAAGTTTAGCTCTCCTTCTGGCTGTCAAGTACATCTTCTTTGAACAAACAGAGACAGAATCTACACTCTCATTAAAAAACCCTATCACATCTCCTGTAGTGACACAAAAGAAAGTCCCAGACAATTGTTGTAGACGTGAACCTATGCTGGTCAGAAATAACCAGAAATGTGATTCAGTAGAGGAAGAGACAGGGATAAACCGAGAAAGAAAAGTTGAGGTTATAAAACCCTTAGTGGCTGAAACAGATACCCCAAACAGAGCTACATTTGTGGTTGGTAACTCCTCCTTACTCGATACTTCATCAGTACTGGTGACACAGGAACCTGAAATTGAACTTCCCAGGGAACCTCGGCCTAATGAAGAATGTCTACAGATACTTGGGAATGCAGAGAAAGGTGCAAAATTCCTTAGTGATGCTGAGATCATCCAGTTAGTCAATGCTAAGCATATCCCAGCCTACAAGTTGGAAACTCTGATGGAAACTCATGAGCGTGGTGTATCTATTCGCCGACAGTTACTTTCCAAGAAGCTTTCAGAACCTTCTTCTCTCCAGTACCTACCTTACAGGGATTATAATTACTCCTTGGTGATGGGAGCTTGTTGTGAGAATGTTATTGGATATATGCCCATCCCTGTTGGAGTGGCAGGACCCCTTTGCTTAGATGAAAAAGAATTTCAGGTTCCAATGGCAACAACAGAAGGTTGTCTTGTGGCCAGCACCAATAGAGGCTGCAGAGCAATAGGTCTTGGTGGAGGTGCCAGCAGCCGAGTCCTTGCAGATGGGATGACTCGTGGCCCAGTTGTGCGTCTTCCACGTGCTTGTGACTCTGCAGAAGTGAAAGCCTGGCTCGAAACATCTGAAGGGTTCGCAGTGATAAAGGAGGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGATGCAGCACAGAATGTTGGTAGTTCAAACTGTATTACTTTAATGGAAGCAAGTGGTCCCACAAATGAAGATTTATATATCAGCTGCACCATGCCATCTATAGAGATAGGAACGGTGGGTGGTGGGACCAACCTACTACCTCAGCAAGCCTGTTTGCAGATGCTAGGTGTTCAAGGAGCATGCAAAGATAATCCTGGGGAAAATGCCCGGCAGCTTGCCCGAATTGTGTGTGGGACCGTAATGGCTGGGGAATTGTCACTTATGGCAGCATTGGCAGCAGGACATCTTGTCAAAAGTCACATGATTCACAACAGGTCGAAGATCAATTTACAAGACCTCCAAGGAGCTTGCACCAAGAAGACAGCCTGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000035-a-2",
        "type": "Protein coding"
    },
    {
        "name": "HMGCR",
        "reference_sequence": {
            "sequence": "ATGTTGTCAAGACTTTTTCGAATGCATGGCCTCTTTGTGGCCTCCCATCCCTGGGAAGTCATAGTGGGGACAGTGACACTGACCATCTGCATGATGTCCATGAACATGTTTACTGGTAACAATAAGATCTGTGGTTGGAATTATGAATGTCCAAAGTTTGAAGAGGATGTTTTGAGCAGTGACATTATAATTCTGACAATAACACGATGCATAGCCATCCTGTATATTTACTTCCAGTTCCAGAATTTACGTCAACTTGGATCAAAATATATTTTGGGTATTGCTGGCCTTTTCACAATTTTCTCAAGTTTTGTATTCAGTACAGTTGTCATTCACTTCTTAGACAAAGAATTGACAGGCTTGAATGAAGCTTTGCCCTTTTTCCTACTTTTGATTGACCTTTCCAGAGCAAGCACATTAGCAAAGTTTGCCCTCAGTTCCAACTCACAGGATGAAGTAAGGGAAAATATTGCTCGTGGAATGGCAATTTTAGGTCCTACGTTTACCCTCGATGCTCTTGTTGAATGTCTTGTGATTGGAGTTGGTACCATGTCAGGGGTACGTCAGCTTGAAATTATGTGCTGCTTTGGCTGCATGTCAGTTCTTGCCAACTACTTCGTGTTCATGACTTTCTTCCCAGCTTGTGTGTCCTTGGTATTAGAGCTTTCTCGGGAAAGCCGCGAGGGTCGTCCAATTTGGCAGCTCAGCCATTTTGCCCGAGTTTTAGAAGAAGAAGAAAATAAGCCGAATCCTGTAACTCAGAGGGTCAAGATGATTATGTCTCTAGGCTTGGTTCTTGTTCATGCTCACAGTCGCTGGATAGCTGATCCTTCTCCTCAAAACAGTACAGCAGATACTTCTAAGGTTTCATTAGGACTGGATGAAAATGTGTCCAAGAGAATTGAACCAAGTGTTTCCCTCTGGCAGTTTTATCTCTCTAAAATGATCAGCATGGATATTGAACAAGTTATTACCCTAAGTTTAGCTCTCCTTCTGGCTGTCAAGTACATCTTCTTTGAACAAACAGAGACAGAATCTACACTCTCATTAAAAAACCCTATCACATCTCCTGTAGTGACACAAAAGAAAGTCCCAGACAATTGTTGTAGACGTGAACCTATGCTGGTCAGAAATAACCAGAAATGTGATTCAGTAGAGGAAGAGACAGGGATAAACCGAGAAAGAAAAGTTGAGGTTATAAAACCCTTAGTGGCTGAAACAGATACCCCAAACAGAGCTACATTTGTGGTTGGTAACTCCTCCTTACTCGATACTTCATCAGTACTGGTGACACAGGAACCTGAAATTGAACTTCCCAGGGAACCTCGGCCTAATGAAGAATGTCTACAGATACTTGGGAATGCAGAGAAAGGTGCAAAATTCCTTAGTGATGCTGAGATCATCCAGTTAGTCAATGCTAAGCATATCCCAGCCTACAAGTTGGAAACTCTGATGGAAACTCATGAGCGTGGTGTATCTATTCGCCGACAGTTACTTTCCAAGAAGCTTTCAGAACCTTCTTCTCTCCAGTACCTACCTTACAGGGATTATAATTACTCCTTGGTGATGGGAGCTTGTTGTGAGAATGTTATTGGATATATGCCCATCCCTGTTGGAGTGGCAGGACCCCTTTGCTTAGATGAAAAAGAATTTCAGGTTCCAATGGCAACAACAGAAGGTTGTCTTGTGGCCAGCACCAATAGAGGCTGCAGAGCAATAGGTCTTGGTGGAGGTGCCAGCAGCCGAGTCCTTGCAGATGGGATGACTCGTGGCCCAGTTGTGCGTCTTCCACGTGCTTGTGACTCTGCAGAAGTGAAAGCCTGGCTCGAAACATCTGAAGGGTTCGCAGTGATAAAGGAGGCATTTGACAGCACTAGCAGATTTGCACGTCTACAGAAACTTCATACAAGTATAGCTGGACGCAACCTTTATATCCGTTTCCAGTCCAGGTCAGGGGATGCCATGGGGATGAACATGATTTCAAAGGGTACAGAGAAAGCACTTTCAAAACTTCACGAGTATTTCCCTGAAATGCAGATTCTAGCCGTTAGTGGTAACTATTGTACTGACAAGAAACCTGCTGCTATAAATTGGATAGAGGGAAGAGGAAAATCTGTTGTTTGTGAAGCTGTCATTCCAGCCAAGGTTGTCAGAGAAGTATTAAAGACTACCACAGAGGCTATGATTGAGGTCAACATTAACAAGAATTTAGTGGGCTCTGCCATGGCTGGGAGCATAGGAGGCTACAACGCCCATGCAGCAAACATTGTCACCGCCATCTACATTGCCTGTGGACAGGATGCAGCACAGAATGTTGGTAGTTCAAACTGTATTACTTTAATGGAAGCAAGTGGTCCCACAAATGAAGATTTATATATCAGCTGCACCATGCCATCTATAGAGATAGGAACGGTGGGTGGTGGGACCAACCTACTACCTCAGCAAGCCTGTTTGCAGATGCTAGGTGTTCAAGGAGCATGCAAAGATAATCCTGGGGAAAATGCCCGGCAGCTTGCCCGAATTGTGTGTGGGACCGTAATGGCTGGGGAATTGTCACTTATGGCAGCATTGGCAGCAGGACATCTTGTCAAAAGTCACATGATTCACAACAGGTCGAAGATCAATTTACAAGACCTCCAAGGAGCTTGCACCAAGAAGACAGCCTGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000035-a-3",
        "type": "Protein coding"
    },
    {
        "name": "HNF4A promoter",
        "reference_sequence": {
            "sequence": "CCCCAGAGTGCAGGACTAGGACCCGAGTGGACCTCAGGTCTGGCCAGGTCGCCATTGCCATGGAGACAGCAACAGTCCCCAGCCGCGGGTTCCCTAAGTGACTGGTTACTCTTTAACGTATCCACCCACCTTGGGTGATTAGAAGAATCAATAAGATAACCGGGCGGTGGCAGCTGGCCGCACTCACCGCCTTCCTGGTGGACGGGCTCCTGGTGGCTGTGCTGCTGCTGTGAGCGGGCCCCTGCTCCTCCATGCCCCCAGCTCTCCGGCTGGGTGGGCTTGGCC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000020-a-1",
        "type": "Regulatory"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-2",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000040-a-1",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-3",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-1",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000011-a-1",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000040-a-3",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-7",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-5",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000040-a-2",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-6",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000040-a-4",
        "type": "Protein coding"
    },
    {
        "name": "HSP90",
        "reference_sequence": {
            "sequence": "CAATTTGGTTGGTCTGCTAATATGGAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 581,
            "identifier": "P02829",
            "url": "http://purl.uniprot.org/uniprot/P02829",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000039-a-4",
        "type": "Protein coding"
    },
    {
        "name": "human L-Selectin",
        "reference_sequence": {
            "sequence": "CCGCTGTTCATCCCGGTTGCAGTTATGGTTACCGCTTTTAGTGGATTGGCGTTTATCATCTGGCTGGCT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 332,
            "identifier": "P14151",
            "url": "http://purl.uniprot.org/uniprot/P14151",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000051-a-1",
        "type": "Protein coding"
    },
    {
        "name": "hYAP65 WW domain",
        "reference_sequence": {
            "sequence": "GACGTTCCACTGCCGGCTGGTTGGGAAATGGCTAAAACTAGTTCTGGTCAGCGTTACTTCCTGAACCACATCGACCAGACCACCACGTGGCAGGACCCGCGT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 169,
            "identifier": "P46937",
            "url": "http://purl.uniprot.org/uniprot/P46937",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000002-a-1",
        "type": "Protein coding"
    },
    {
        "name": "hYAP65 WW domain",
        "reference_sequence": {
            "sequence": "GACGTTCCACTGCCGGCTGGTTGGGAAATGGCTAAAACTAGTTCTGGTCAGCGTTACTTCCTGAACCACATCGACCAGACCACCACGTGGCAGGACCCGCGT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 169,
            "identifier": "P46937",
            "url": "http://purl.uniprot.org/uniprot/P46937",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000002-a-2",
        "type": "Protein coding"
    },
    {
        "name": "IRF4 enhancer",
        "reference_sequence": {
            "sequence": "GGCGTGTCCGCCTGTTGGAATATGCTTCTCAGGTCTTCTGGGAAACAGATGTTTTGTGGAAGTGGAAGATTTTGGAAGTAGTGCCTTATCATGTGAAACCACAGGGCAGCTGATCTCTTCAGGCTTTCTTGATGTGAATGACAGCTTTGTTTCATCCACTTTGGTGGGTAAAAGAAGGCAAATTCCCCTGTGGTACTTTTGGTGCCAGGTTTAGCCATATGACGAAGCTTTACATAAAACAGTACAAGTATCTCCATTGTCCTTTATGATCCTCCATGAGTGTTTTCACTTAGTCTGATGAAGGGTTCACTCCAGTCTTTTCGGATGATAAAATGCTTCGGCTGTCAGTCTAATAAGGGATTCCCTGAGGAGTTTGGAGGCTGTAAGAGCACCCCCCGTCTCAATGCCAGTGCTTCTTATCTCAGCCTCTCCTGCACTCCTTTACCCCCGT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000021-a-1",
        "type": "Regulatory"
    },
    {
        "name": "IRF6 enhancer",
        "reference_sequence": {
            "sequence": "GTAAATGGTGAGTAGGAAGTTGATTCTGCCCGATCTGTCTGACTCCATGCCCTTTCTATTAGGTCATGAAGGGGAACCTGAGGATTGGAGCTTTGGAATGTTAATCTTACCCAAAGGCCTGAAGTAATACCCCAGAATGTGAACATGTGTGACCATCTGCCTGTCCTGGGGGTGGGAAGAAGGCAGCATGCTCTATCCTTGACCCTGATTGAGCCCAGGGGCTGAATCTGGAGCTTTGGGGCCTGGGAACCTCTCTACCTGCGTCAATGTCTGGAGGCCCTGAGAGTTTCGCTCAGGCTCAGAGCAGGCATCGCAACCTCCCAGTTACTATTCTGTGCTGTGGCAAGTGCCAGCTTGTCCTCTCTTCCCCACCCAGCCCGGGAAACCGGCAGCATTTCTAGTTCAGGCCCAGACCCGTCCTGGCAGCCTGGATTCCACTGCCTAGGCAGGAAGCTCATCTCAGCCCAGTGACCTTTTCTCTCTGTTTTTTGTCACAGAGGAATTTCCATGCCAGCAGTATGGGGCAATGGGGGTGGGTGGCCAAAGGTTTCCCCCTTAAGCCACAAGAGCCATGGAGTGGAGGTAAGCTAAGCAAACAGAG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000022-a-1",
        "type": "Regulatory"
    },
    {
        "name": "LamB",
        "reference_sequence": {
            "sequence": "ATGATGATTACTCTGCGCAAACTTCCTCTGGCGGTTGCCGTCGCAGCGGGCGTAATGTCTGCTCAGGCAATGGCTGTTGATTTCCACGGCTATGCACGTTCCGGTATTGGTTGGACAGGTAGCGGCGGTGAACAACAGTGTTTCCAGACTACCGGTGCTCAAAGTAAATACCGTCTTGGCAACGAATGTGAAACTTATGCTGAATTAAAATTGGGTCAGGAAGTGTGGAAAGAGGGCGATAAGAGCTTCTATTTCGACACTAACGTGGCCTATTCCGTCGCACAACAGAATGACTGGGAAGCTACCGATCCGGCCTTCCGTGAAGCAAACGTGCAGGGTAAAAACCTGATCGAATGGCTGCCAGGCTCCACCATCTGGGCAGGTAAGCGCTTCTACCAACGTCATGACGTTCATATGATCGACTTCTACTACTGGGATATTTCTGGTCCTGGTGCCGGTCTGGAAAACATCGATGTTGGCTTCGGTAAACTCTCTCTGGCAGCAACCCGCTCCTCTGAAGCTGGTGGTTCTTCCTCTTTCGCCAGCAACAATATTTATGACTATACCAACGAAACCGCGAACGACGTTTTCGATGTGCGTTTAGCGCAGATGGAAATCAACCCGGGCGGCACATTAGAACTGGGTGTCGACTACGGTCGTGCCAACTTGCGTGATAACTATCGTCTGGTTGATGGCGCATCGAAAGACGGCTGGTTATTCACTGCTGAACATACTCAGAGTGTCCTGAAGGGCTTTAACAAGTTTGTTGTTCAGTACGCTACTGACTCGATGACCTCGCAGGGTAAAGGGCTGTCGCAGGGTTCTGGCGTTGCATTTGATAACGAAAAATTTGCCTACAATATCAACAACAACGGTCACATGCTGCGTATCCTCGACCACGGTGCGATCTCCATGGGCGACAACTGGGACATGATGTACGTGGGTATGTACCAGGATATCAACTGGGATAACGACAACGGCACCAAGTGGTGGACCGTCGGTATTCGCCCGATGTACAAGTGGACGCCAATCATGAGCACCGTGATGGAAATCGGCTACGACAACGTCGAATCCCAGCGCACCGGCGACAAGAACAATCAGTACAAAATTACCCTCGCACAACAATGGCAGGCTGGCGACAGCATCTGGTCACGCCCGGCTATTCGTGTCTTCGCAACCTACGCCAAGTGGGATGAGAAATGGGGTTACGACTACACCGGTAACGCTGATAACAACGCGAACTTCGGCAAAGCCGTTCCTGCTGATTTCAACGGCGGCAGCTTCGGTCGTGGCGACAGCGACGAGTGGACCTTCGGTGCCCAGATGGAAATCTGGTGGTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P02943",
            "url": "http://purl.uniprot.org/uniprot/P02943",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000064-b-1",
        "type": "Protein coding"
    },
    {
        "name": "LamB",
        "reference_sequence": {
            "sequence": "ATGATGATTACTCTGCGCAAACTTCCTCTGGCGGTTGCCGTCGCAGCGGGCGTAATGTCTGCTCAGGCAATGGCTGTTGATTTCCACGGCTATGCACGTTCCGGTATTGGTTGGACAGGTAGCGGCGGTGAACAACAGTGTTTCCAGACTACCGGTGCTCAAAGTAAATACCGTCTTGGCAACGAATGTGAAACTTATGCTGAATTAAAATTGGGTCAGGAAGTGTGGAAAGAGGGCGATAAGAGCTTCTATTTCGACACTAACGTGGCCTATTCCGTCGCACAACAGAATGACTGGGAAGCTACCGATCCGGCCTTCCGTGAAGCAAACGTGCAGGGTAAAAACCTGATCGAATGGCTGCCAGGCTCCACCATCTGGGCAGGTAAGCGCTTCTACCAACGTCATGACGTTCATATGATCGACTTCTACTACTGGGATATTTCTGGTCCTGGTGCCGGTCTGGAAAACATCGATGTTGGCTTCGGTAAACTCTCTCTGGCAGCAACCCGCTCCTCTGAAGCTGGTGGTTCTTCCTCTTTCGCCAGCAACAATATTTATGACTATACCAACGAAACCGCGAACGACGTTTTCGATGTGCGTTTAGCGCAGATGGAAATCAACCCGGGCGGCACATTAGAACTGGGTGTCGACTACGGTCGTGCCAACTTGCGTGATAACTATCGTCTGGTTGATGGCGCATCGAAAGACGGCTGGTTATTCACTGCTGAACATACTCAGAGTGTCCTGAAGGGCTTTAACAAGTTTGTTGTTCAGTACGCTACTGACTCGATGACCTCGCAGGGTAAAGGGCTGTCGCAGGGTTCTGGCGTTGCATTTGATAACGAAAAATTTGCCTACAATATCAACAACAACGGTCACATGCTGCGTATCCTCGACCACGGTGCGATCTCCATGGGCGACAACTGGGACATGATGTACGTGGGTATGTACCAGGATATCAACTGGGATAACGACAACGGCACCAAGTGGTGGACCGTCGGTATTCGCCCGATGTACAAGTGGACGCCAATCATGAGCACCGTGATGGAAATCGGCTACGACAACGTCGAATCCCAGCGCACCGGCGACAAGAACAATCAGTACAAAATTACCCTCGCACAACAATGGCAGGCTGGCGACAGCATCTGGTCACGCCCGGCTATTCGTGTCTTCGCAACCTACGCCAAGTGGGATGAGAAATGGGGTTACGACTACACCGGTAACGCTGATAACAACGCGAACTTCGGCAAAGCCGTTCCTGCTGATTTCAACGGCGGCAGCTTCGGTCGTGGCGACAGCGACGAGTGGACCTTCGGTGCCCAGATGGAAATCTGGTGGTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P02943",
            "url": "http://purl.uniprot.org/uniprot/P02943",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000064-a-1",
        "type": "Protein coding"
    },
    {
        "name": "LDLRAP1",
        "reference_sequence": {
            "sequence": "ATGGACGCGCTCAAGTCGGCGGGGCGGGCGCTGATCCGGAGCCCCAGCTTGGCCAAGCAGAGCTGGGGGGGCGGTGGCCGGCACCGCAAGCTGCCTGAGAACTGGACAGACACGCGGGAGACGCTGCTGGAGGGGATGCTGTTCAGCCTCAAGTACCTGGGCATGACGCTAGTGGAGCAGCCCAAGGGTGAGGAGCTGTCGGCCGCCGCCATCAAGAGGATCGTGGCTACAGCTAAGGCCAGTGGGAAGAAGCTGCAGAAGGTGACTCTGAAGGTGTCGCCACGGGGAATTATCCTGACAGACAACCTCACCAACCAGCTCATTGAGAACGTGTCCATATACAGGATCTCCTATTGCACAGCAGACAAGATGCACGACAAGGTGTTTGCATACATCGCCCAGAGCCAGCACAACCAGAGCCTCGAGTGCCACGCCTTCCTCTGCACCAAGCGGAAGATGGCACAGGCTGTTACCCTCACCGTAGCCCAGGCCTTCAAAGTCGCCTTTGAGTTTTGGCAGGTGTCCAAGGAAGAGAAAGAGAAGAGGGACAAAGCCAGCCAAGAGGGAGGGGACGTCCTGGGGGCCCGCCAAGACTGCACCCCCCCCTTGAAGAGCTTGGTCGCCACTGGGAACCTGCTGGACTTAGAGGAGACGGCTAAGGCCCCGCTGTCCACGGTCAGCGCCAACACCACCAACATGGACGAGGTGCCGCGGCCACAAGCCTTGAGTGGCAGCAGTGTTGTCTGGGAGCTGGATGATGGCCTGGATGAAGCGTTTTCGAGGCTTGCCCAGTCTCGGACAAACCCTCAGGTCCTGGACACTGGCCTGACAGCCCAGGACATGCATTACGCCCAGTGCCTCTCGCCTGTCGACTGGGACAAGCCTGACAGCAGCGGCACAGAGCAGGATGACCTCTTCAGCTTCTGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000036-a-2",
        "type": "Protein coding"
    },
    {
        "name": "LDLRAP1",
        "reference_sequence": {
            "sequence": "ATGGACGCGCTCAAGTCGGCGGGGCGGGCGCTGATCCGGAGCCCCAGCTTGGCCAAGCAGAGCTGGGGGGGCGGTGGCCGGCACCGCAAGCTGCCTGAGAACTGGACAGACACGCGGGAGACGCTGCTGGAGGGGATGCTGTTCAGCCTCAAGTACCTGGGCATGACGCTAGTGGAGCAGCCCAAGGGTGAGGAGCTGTCGGCCGCCGCCATCAAGAGGATCGTGGCTACAGCTAAGGCCAGTGGGAAGAAGCTGCAGAAGGTGACTCTGAAGGTGTCGCCACGGGGAATTATCCTGACAGACAACCTCACCAACCAGCTCATTGAGAACGTGTCCATATACAGGATCTCCTATTGCACAGCAGACAAGATGCACGACAAGGTGTTTGCATACATCGCCCAGAGCCAGCACAACCAGAGCCTCGAGTGCCACGCCTTCCTCTGCACCAAGCGGAAGATGGCACAGGCTGTTACCCTCACCGTAGCCCAGGCCTTCAAAGTCGCCTTTGAGTTTTGGCAGGTGTCCAAGGAAGAGAAAGAGAAGAGGGACAAAGCCAGCCAAGAGGGAGGGGACGTCCTGGGGGCCCGCCAAGACTGCACCCCCCCCTTGAAGAGCTTGGTCGCCACTGGGAACCTGCTGGACTTAGAGGAGACGGCTAAGGCCCCGCTGTCCACGGTCAGCGCCAACACCACCAACATGGACGAGGTGCCGCGGCCACAAGCCTTGAGTGGCAGCAGTGTTGTCTGGGAGCTGGATGATGGCCTGGATGAAGCGTTTTCGAGGCTTGCCCAGTCTCGGACAAACCCTCAGGTCCTGGACACTGGCCTGACAGCCCAGGACATGCATTACGCCCAGTGCCTCTCGCCTGTCGACTGGGACAAGCCTGACAGCAGCGGCACAGAGCAGGATGACCTCTTCAGCTTCTGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000036-a-1",
        "type": "Protein coding"
    },
    {
        "name": "LDLR promoter",
        "reference_sequence": {
            "sequence": "AGCTCTTCACCGGAGACCCAAATACAACAAATCAAGTCGCCTGCCCTGGCGACACTTTCGAAGGACTGGAGTGGGAATCAGAGCTTCACGGGTTAAAAAGCCGATGTCACATCGGCCGTTCGAAACTCCTCCTCTTGCAGTGAGGTGAAGACATTTGAAAATCACCCCACTGCAAACTCCTCCCCCTGCTAGAAACCTCACATTGAAATGCTGTAAATGACGTGGGCCCCGAGTGCAATCGCGGGAAGCCAGGGTTTCCAGCTAGGACACAGCAGGTCGTGATCCGGGTCGGGACACTGCCTGGCAGAGGCTGCGAGC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000023-a-2",
        "type": "Regulatory"
    },
    {
        "name": "LDLR promoter",
        "reference_sequence": {
            "sequence": "AGCTCTTCACCGGAGACCCAAATACAACAAATCAAGTCGCCTGCCCTGGCGACACTTTCGAAGGACTGGAGTGGGAATCAGAGCTTCACGGGTTAAAAAGCCGATGTCACATCGGCCGTTCGAAACTCCTCCTCTTGCAGTGAGGTGAAGACATTTGAAAATCACCCCACTGCAAACTCCTCCCCCTGCTAGAAACCTCACATTGAAATGCTGTAAATGACGTGGGCCCCGAGTGCAATCGCGGGAAGCCAGGGTTTCCAGCTAGGACACAGCAGGTCGTGATCCGGGTCGGGACACTGCCTGGCAGAGGCTGCGAGC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000023-a-1",
        "type": "Regulatory"
    },
    {
        "name": "LTV1 enhancer",
        "reference_sequence": {
            "sequence": "CTTTGGGTGACCCCTGACCCTGGCCGCCTGGGCTCGCCTTCCCGCACATTCCGTCCTCGCCGCCCCGCCCCACCCCGCCCTCCTTCCTTGGCCCTGTGGGGACGGAAACATCCCGTTCCTGCCCAAGCTGGGTCAAGAGCCGGAGGGACAGGACCAGAGCACCCCTTACGCCAGAACTAGCTCTCCTTGTTCCTACTGGGTGACCTCATCTCGCCACGCCTCCTCAGGTGAACACCCGGGCTGGTAACGTCACTTCCTGCCAGGTAAGCGCCCCCAGGCAGCACTGCTCACGGAAAGGTCTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "mm9",
                    "organism_name": "Mus musculus",
                    "assembly_identifier": {
                        "identifier": "GCF_000001635.18",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.18",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000008-a-1",
        "type": "Regulatory"
    },
    {
        "name": "LTV1 enhancer",
        "reference_sequence": {
            "sequence": "CTTTGGGTGACCCCTGACCCTGGCCGCCTGGGCTCGCCTTCCCGCACATTCCGTCCTCGCCGCCCCGCCCCACCCCGCCCTCCTTCCTTGGCCCTGTGGGGACGGAAACATCCCGTTCCTGCCCAAGCTGGGTCAAGAGCCGGAGGGACAGGACCAGAGCACCCCTTACGCCAGAACTAGCTCTCCTTGTTCCTACTGGGTGACCTCATCTCGCCACGCCTCCTCAGGTGAACACCCGGGCTGGTAACGTCACTTCCTGCCAGGTAAGCGCCCCCAGGCAGCACTGCTCACGGAAAGGTCTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "mm9",
                    "organism_name": "Mus musculus",
                    "assembly_identifier": {
                        "identifier": "GCF_000001635.18",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001635.18",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000008-a-2",
        "type": "Regulatory"
    },
    {
        "name": "MPL",
        "reference_sequence": {
            "sequence": "ACCGAGACCGCCTGGATCTCCTTGGTGACCGCTCTGCATCTAGTGCTGGGCCTCAGCGCCGTCCTGGGCCTGCTGCTGCTGAGGTGGCAGTTT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 486,
            "identifier": "P40238",
            "url": "http://purl.uniprot.org/uniprot/P40238",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000043-a-1",
        "type": "Protein coding"
    },
    {
        "name": "MSH2",
        "reference_sequence": {
            "sequence": "ATGGCGGTGCAGCCGAAGGAGACGCTGCAGTTGGAGAGCGCGGCCGAGGTCGGCTTCGTGCGCTTCTTTCAGGGCATGCCGGAGAAGCCGACCACCACAGTGCGCCTTTTCGACCGGGGCGACTTCTATACGGCGCACGGCGAGGACGCGCTGCTGGCCGCCCGGGAGGTGTTCAAGACCCAGGGGGTGATCAAGTACATGGGGCCGGCAGGAGCAAAGAATCTGCAGAGTGTTGTGCTTAGTAAAATGAATTTTGAATCTTTTGTAAAAGATCTTCTTCTGGTTCGTCAGTATAGAGTTGAAGTTTATAAGAATAGAGCTGGAAATAAGGCATCCAAGGAGAATGATTGGTATTTGGCATATAAGGCTTCTCCTGGCAATCTCTCTCAGTTTGAAGACATTCTCTTTGGTAACAATGATATGTCAGCTTCCATTGGTGTTGTGGGTGTTAAAATGTCCGCAGTTGATGGCCAGAGACAGGTTGGAGTTGGGTATGTGGATTCCATACAGAGGAAACTAGGACTGTGTGAATTCCCTGATAATGATCAGTTCTCCAATCTTGAGGCTCTCCTCATCCAGATTGGACCAAAGGAATGTGTTTTACCCGGAGGAGAGACTGCTGGAGACATGGGGAAACTGAGACAGATAATTCAAAGAGGAGGAATTCTGATCACAGAAAGAAAAAAAGCTGACTTTTCCACAAAAGACATTTATCAGGACCTCAACCGGTTGTTGAAAGGCAAAAAGGGAGAGCAGATGAATAGTGCTGTATTGCCAGAAATGGAGAATCAGGTTGCAGTTTCATCACTGTCTGCGGTAATCAAGTTTTTAGAACTCTTATCAGATGATTCCAACTTTGGACAGTTTGAACTGACTACTTTTGACTTCAGCCAGTATATGAAATTGGATATTGCAGCAGTCAGAGCCCTTAACCTTTTTCAGGGTTCTGTTGAAGATACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCCCTCAAGGACAAAGACTTGTTAACCAGTGGATTAAGCAGCCTCTCATGGATAAGAACAGAATAGAGGAGAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTTCGTCGATTCCCAGATCTTAACCGACTTGCCAAGAAGTTTCAAAGACAAGCAGCAAACTTACAAGATTGTTACCGACTCTATCAGGGTATAAATCAACTACCTAATGTTATACAGGCTCTGGAAAAACATGAAGGAAAACACCAGAAATTATTGTTGGCAGTTTTTGTGACTCCTCTTACTGATCTTCGTTCTGACTTCTCCAAGTTTCAGGAAATGATAGAAACAACTTTAGATATGGATCAGGTGGAAAACCATGAATTCCTTGTAAAACCTTCATTTGATCCTAATCTCAGTGAATTAAGAGAAATAATGAATGACTTGGAAAAGAAGATGCAGTCAACATTAATAAGTGCAGCCAGAGATCTTGGCTTGGACCCTGGCAAACAGATTAAACTGGATTCCAGTGCACAGTTTGGATATTACTTTCGTGTAACCTGTAAGGAAGAAAAAGTCCTTCGTAACAATAAAAACTTTAGTACTGTAGATATCCAGAAGAATGGTGTTAAATTTACCAACAGCAAATTGACTTCTTTAAATGAAGAGTATACCAAAAATAAAACAGAATATGAAGAAGCCCAGGATGCCATTGTTAAAGAAATTGTCAATATTTCTTCAGGCTATGTAGAACCAATGCAGACACTCAATGATGTGTTAGCTCAGCTAGATGCTGTTGTCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGAGAAAGGACAAGGAAGAATTATATTAAAAGCATCCAGGCATGCTTGTGTTGAAGTTCAAGATGAAATTGCATTTATTCCTAATGACGTATACTTTGAAAAAGATAAACAGATGTTCCACATCATTACTGGCCCCAATATGGGAGGTAAATCAACATATATTCGACAAACTGGGGTGATAGTACTCATGGCCCAAATTGGGTGTTTTGTGCCATGTGAGTCAGCAGAAGTGTCCATTGTGGACTGCATCTTAGCCCGAGTAGGGGCTGGTGACAGTCAATTGAAAGGAGTCTCCACGTTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATTCATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGGGTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATGTTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTAATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCAGGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCTAATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGGAGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAAGAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCCAAGGTGAAACAAATGCCCTTTACTGAAATGTCAGAAGAAAACATCACAATAAAGTTAAAACAGCTAAAAGCTGAAGTAATAGCAAAGAATAATAGCTTTGTAAATGAAATCATTTCACGAATAAAAGTTACTACGTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P43246",
            "url": "http://purl.uniprot.org/uniprot/P43246",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": {
            "offset": 0,
            "identifier": "NP_000242.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_000242.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000050-a-1",
        "type": "Protein coding"
    },
    {
        "name": "MSMB promoter",
        "reference_sequence": {
            "sequence": "AAGCAGGACTCCTTATAGACAGGTACATCCAGGCAAAGCTGCATCAAACTTTTATACTGGAGAGGGCAACCACGCATTCGACATCATTGGGAATGATAACAAGGTGAGAACACATTGAGTGTTTACAGAGGGTTGACTATCAAAAGGAAAGTATGGTTTCAGATGATTTATGAGTTATTAATCAATCACATCTCCACCCAAGTTATGTGTTTACCTTGTCCCCACCCCGATCTGCATTTGCTGCTGACCTAAAAGAGCAGAGGAGGAGAGAACTTCTCTTTGCTGAGCCTTCGCCCTATGCTGGTGGATTGCTAGCACGTGATGTGTCCTTATTCGATTTTATACACAAAGAAACAGCCTCAGCGATGCCAGTCACAACAGCCAGGTGGTAAAGGTGGGTTTCCTGAAGGCATAAGAATAGCCCACAGGTCAGCCCACCAGGCCCACCGGGCCTGGGTCTGTGGCCCAGATGACCCTGCCCTTAGGGTCTGACATGAGAACAGAAATGGGTCAAGCCATCCTGCAGGGCACAGGAGAGCAAGAACTACATACAGCTCGGGGTTCCCTGACAAGCTGAATTGCTGGACCTTT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000024-a-1",
        "type": "Regulatory"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-2",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-1",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-6",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-7",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-3",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-4",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-5",
        "type": "Protein coding"
    },
    {
        "name": "MTHFR",
        "reference_sequence": {
            "sequence": "ATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCAACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTCGAGATGTTCCACCCCGGGCCTGGACCCCGAGCGGCATGAGAGACTCCGGGAGAAGATGAGGCGGCGATTGGAATCTGGTGACAAGTGGTTCTCCCTGGAATTCTTCCCTCCTCGAACTGCTGAGGGAGCTGTCAATCTCATCTCAAGGTTTGACCGGATGGCAGCAGGTGGCCCCCTCTACATAGACGTGACCTGGCACCCAGCAGGTGACCCTGGCTCAGACAAGGAGACCTCCTCCATGATGATCGCCAGCACCGCCGTGAACTACTGTGGCCTGGAGACCATCCTGCACATGACCTGCTGCCGTCAGCGCCTGGAGGAGATCACGGGCCATCTGCACAAAGCTAAGCAGCTGGGCCTGAAGAACATCATGGCGCTGCGGGGAGACCCAATAGGTGACCAGTGGGAAGAGGAGGAGGGAGGCTTCAACTACGCAGTGGACCTGGTGAAGCACATCCGAAGTGAGTTTGGTGACTACTTTGACATCTGTGTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGGCTACCACTCCCTTCGGCAGCTTGTGAAGCTGTCCAAGCTGGAGGTGCCACAGGAGATCAAGGACGTGATTGAGCCAATCAAAGACAACGATGCTGCCATCCGCAACTATGGCATCGAGCTGGCCGTGAGCCTGTGCCAGGAGCTTCTGGCCAGTGGCTTGGTGCCAGGCCTCCACTTCTACACCCTCAACCGCGAGATGGCTACCACAGAGGTGCTGAAGCGCCTGGGGATGTGGACTGAGGACCCCAGGCGTCCCCTACCCTGGGCTCTCAGCGCCCACCCCAAGCGCCGAGAGGAAGATGTACGTCCCATCTTCTGGGCCTCCAGACCAAAGAGTTACATCTACCGTACCCAGGAGTGGGACGAGTTCCCTAACGGCCGCTGGGGCAATTCCTCTTCCCCTGCCTTTGGGGAGCTGAAGGACTACTACCTCTTCTACCTGAAGAGCAAGTCCCCCAAGGAGGAGCTGCTGAAGATGTGGGGGGAGGAGCTGACCAGTGAAGAAAGTGTCTTTGAAGTCTTCGTTCTTTACCTCTCGGGAGAACCAAACCGGAATGGTCACAAAGTGACTTGCCTGCCCTGGAACGATGAGCCCCTGGCGGCTGAGACCAGCCTGCTGAAGGAGGAGCTGCTGCGGGTGAACCGCCAGGGCATCCTCACCATCAACTCACAGCCCAACATCAACGGGAAGCCGTCCTCCGACCCCATCGTGGGCTGGGGCCCCAGCGGGGGCTATGTCTTCCAGAAGGCCTACTTAGAGTTTTTCACTTCCCGCGAGACAGCGGAAGCACTTCTGCAAGTGCTGAAGAAGTACGAGCTCCGGGTTAATTACCACCTTGTCAATGTGAAGGGTGAAAACATCACCAATGCCCCTGAACTGCAGCCGAATGCTGTCACTTGGGGCATCTTCCCTGGGCGAGAGATCATCCAGCCCACCGTAGTGGATCCCGTCAGCTTCATGTTCTGGAAGGACGAGGCCTTTGCCCTGTGGATTGAGCGGTGGGGAAAGCTGTATGAGGAGGAGTCCCCGTCCCGCACCATCATCCAGTACATCCACGACAACTACTTCCTGGTCAACCTGGTGGACAATGACTTCCCACTGGACAACTGCCTCTGGCAGGTGGTGGAAGACACATTGGAGCTTCTCAACAGGCCCACCCAGAATGCGAGAGAAACGGAGGCTCCATGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P42898",
            "url": "http://purl.uniprot.org/uniprot/P42898",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000177000",
            "url": "http://www.ensembl.org/id/ENSG00000177000",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 230,
            "identifier": "NM_005957",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_005957",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000049-a-8",
        "type": "Protein coding"
    },
    {
        "name": "MYC enhancer (rs11986220)",
        "reference_sequence": {
            "sequence": "GGTAAGTCAACATGAAATTATAAACCATGTTTAACTAACCCACAAGAAAAACAGAAAAAGAAAACAGATACATGAAAATCTGAGAGGAAAAAAAAAAAACAGAGAACACAATGGGAAGCTTCATTCAATGTAAGGGTACTAGAAGTTCTAGCCAGTGCAATTAAGAGGAAAAAAATAAATAAAAAGGCATATGTGTTGAAAGGAAGAAATTAAACTGTCTTTATTTGCAAATGACATGATTATCAGCACAGATAATCAAGATAAATATATAAAAAGATTTCTGAAACTAATAAGTTAGTTCAGTAAGGTCGTAAGCTATAAGACAAACAAAGGAAAATCAATTGTATTTGAATGTATCGACAGTAAACATATGGACATTAAAATTAACAATACAATATAATTTATATTTATTAAAAATATAAAATGCTTAGGCATAAATCTAACAAAACCCCCACAGTACTTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000026-a-1",
        "type": "Regulatory"
    },
    {
        "name": "MYC enhancer (rs6983267)",
        "reference_sequence": {
            "sequence": "CTGCATCGCTCCATAGAGCCTGCAGAGGGCACTAGACTGGGAATTAGAAAACCTGATTTCCCTTCCAGCTCCACCTCTGACCAATTGCCTGACCCTGGTCAAATTGCTTAACCTCTTCCTATCTCAGCTCCCTATCCATAAAACAGAGGGACGAATAAACTCTCCTCCTACCACTAAGAGGTGTAGCCAGAGTTAATACCCTCATCGTCCTTTGAGCTCAGCAGATGAAAGGCACTGAGAAAAGTACAAAGAATTTTTATGTGCTATTGACTTTATTTTATTTTATGTGGGGGAGGGAGCCGGCCCCAGCTGGAAAGCTGCTTTCTCTGAATCAAAGGGCAGGAACCCAGCAAGTTTCTCAGGATTGGGGCCTTAGACTGGGCTGTGTATACAGACAGTGCCAGCCAACCCCACAGTTCAGTTTCCTTTAACCTGGTGCTCCAGGCAATAACTGTGCAACTCTGCAATTTAACAATGTGTTCTTTGTCCCACAACTGTTCTCGTTTCTCAACTGCCCAGGTAATATGTTTGGGCCTGTAGGAAGAGTCAAATAGTTAATAAGGGAAGGGTTTGGCATGCCCTACGTAAGTTCTACCAGCA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000025-a-1",
        "type": "Regulatory"
    },
    {
        "name": "NUDT15",
        "reference_sequence": {
            "sequence": "ATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGGAGTCGGAGTCGGAGTCGTGGTGACCAGCTGCAAGCATCCGCGTTGCGTCCTCCTGGGGAAGAGGAAAGGCTCGGTTGGAGCTGGCAGTTTCCAACTCCCTGGAGGTCATCTGGAGTTCGGTGAAACCTGGGAAGAATGTGCTCAAAGGGAAACCTGGGAAGAAGCAGCTCTTCACCTGAAAAATGTTCACTTTGCCTCAGTTGTGAATTCTTTCATTGAGAAGGAGAATTACCATTATGTTACTATATTAATGAAAGGAGAAGTGGATGTGACTCATGATTCAGAACCAAAGAATGTAGAGCCTGAAAAAAATGAAAGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTGCGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "Q9NV35",
            "url": "http://purl.uniprot.org/uniprot/Q9NV35",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000055-b-1",
        "type": "Protein coding"
    },
    {
        "name": "NUDT15",
        "reference_sequence": {
            "sequence": "ATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGGAGTCGGAGTCGGAGTCGTGGTGACCAGCTGCAAGCATCCGCGTTGCGTCCTCCTGGGGAAGAGGAAAGGCTCGGTTGGAGCTGGCAGTTTCCAACTCCCTGGAGGTCATCTGGAGTTCGGTGAAACCTGGGAAGAATGTGCTCAAAGGGAAACCTGGGAAGAAGCAGCTCTTCACCTGAAAAATGTTCACTTTGCCTCAGTTGTGAATTCTTTCATTGAGAAGGAGAATTACCATTATGTTACTATATTAATGAAAGGAGAAGTGGATGTGACTCATGATTCAGAACCAAAGAATGTAGAGCCTGAAAAAAATGAAAGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTGCGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "Q9NV35",
            "url": "http://purl.uniprot.org/uniprot/Q9NV35",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000056-a-1",
        "type": "Protein coding"
    },
    {
        "name": "NUDT15",
        "reference_sequence": {
            "sequence": "ATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGGAGTCGGAGTCGGAGTCGTGGTGACCAGCTGCAAGCATCCGCGTTGCGTCCTCCTGGGGAAGAGGAAAGGCTCGGTTGGAGCTGGCAGTTTCCAACTCCCTGGAGGTCATCTGGAGTTCGGTGAAACCTGGGAAGAATGTGCTCAAAGGGAAACCTGGGAAGAAGCAGCTCTTCACCTGAAAAATGTTCACTTTGCCTCAGTTGTGAATTCTTTCATTGAGAAGGAGAATTACCATTATGTTACTATATTAATGAAAGGAGAAGTGGATGTGACTCATGATTCAGAACCAAAGAATGTAGAGCCTGAAAAAAATGAAAGTTGGGAGTGGGTTCCTTGGGAAGAACTACCTCCCCTGGACCAGCTTTTCTGGGGACTGCGTTGTTTAAAAGAACAAGGCTATGATCCATTTAAAGAAGATCTGAACCATCTGGTGGGATACAAAGGAAATCATCTCTAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "Q9NV35",
            "url": "http://purl.uniprot.org/uniprot/Q9NV35",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000055-a-1",
        "type": "Protein coding"
    },
    {
        "name": "p53",
        "reference_sequence": {
            "sequence": "ACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGGCATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 101,
            "identifier": "P04637",
            "url": "http://purl.uniprot.org/uniprot/P04637",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000059-a-1",
        "type": "Protein coding"
    },
    {
        "name": "PAB1",
        "reference_sequence": {
            "sequence": "GGTAACATCTTTATCAAGAACTTGCACCCTGATATTGACAACAAGGCTTTGTATGACACTTTCTCTGTGTTTGGTGACATCTTGTCCAGCAAGATTGCCACCGACGAAAACGGAAAATCCAAGGGTTTTGGGTTTGTTCACTTCGAAGAAGAAGGTGCTGCCAAGGAAGCTATTGATGCTTTGAATGGTATGCTGTTGAACGGTCAAGAAATTTATGTTGCTCCT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 125,
            "identifier": "P04147",
            "url": "http://purl.uniprot.org/uniprot/P04147",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000010-a-1",
        "type": "Protein coding"
    },
    {
        "name": "PKLR promoter",
        "reference_sequence": {
            "sequence": "TGCTTTCAGTGTGGGCCTGGGGCTGCGGGACCATGGAATGAGAGGGAGAGGATGACAAAACTGCTGGTCTTATCTAAGGGAGACAGAGAAGAGAAAAGGGGCACACCCAGTAGGCCACCCTGTCCCCACAGAATCCCTCCCCCAGAACGGCCTGCTCTCTGCCCTCATCTCCTGGCATTTCCTCTCATCCTTTTTTCCTGATAAATTTTCAATCCATTCATACTATCTGGTCATCCACGTGAATAGATATTTTTTTTTTGGCCAGTCATATGGCCCCATTTTCTTTGTACTTTACTGAAGTTAGCTCTAGTGAATCCAGGGAGCAGGGGCTGTAGGGTGGGGCTGGAGCCTGAAGAAAGACAAAAGGGATCACTGTGATAATATGGTGGGGGGAGGGTTACCCAGTTCTGACCACTTTTTTTCTCTGTCTCAACCAAGAAATGCAGAGTGCCTTCACCACTCTGTAACCT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000027-a-1",
        "type": "Regulatory"
    },
    {
        "name": "PKLR promoter",
        "reference_sequence": {
            "sequence": "TGCTTTCAGTGTGGGCCTGGGGCTGCGGGACCATGGAATGAGAGGGAGAGGATGACAAAACTGCTGGTCTTATCTAAGGGAGACAGAGAAGAGAAAAGGGGCACACCCAGTAGGCCACCCTGTCCCCACAGAATCCCTCCCCCAGAACGGCCTGCTCTCTGCCCTCATCTCCTGGCATTTCCTCTCATCCTTTTTTCCTGATAAATTTTCAATCCATTCATACTATCTGGTCATCCACGTGAATAGATATTTTTTTTTTGGCCAGTCATATGGCCCCATTTTCTTTGTACTTTACTGAAGTTAGCTCTAGTGAATCCAGGGAGCAGGGGCTGTAGGGTGGGGCTGGAGCCTGAAGAAAGACAAAAGGGATCACTGTGATAATATGGTGGGGGGAGGGTTACCCAGTTCTGACCACTTTTTTTCTCTGTCTCAACCAAGAAATGCAGAGTGCCTTCACCACTCTGTAACCT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000027-b-1",
        "type": "Regulatory"
    },
    {
        "name": "PSD95 PDZ3",
        "reference_sequence": {
            "sequence": "CCACGCCGCATCGTCATCCACCGTGGGTCAACGGGGTTAGGCTTCAATATCGTCGGTGGAGAGGATGGTGAGGGAATCTTCATCTCATTCATTCTGGCGGGAGGACCGGCCGATTTAAGCGGAGAACTTCGCAAAGGTGACCAGATCCTTTCGGTGAATGGCGTAGATTTGCGCAACGCATCACACGAACAGGCGGCCATCGCATTAAAGAACGCCGGCCAGACCGTTACGATTATCGCGCAGTATAAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 309,
            "identifier": "P78352",
            "url": "http://purl.uniprot.org/uniprot/P78352",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000053-a-1",
        "type": "Protein coding"
    },
    {
        "name": "PSD95 PDZ3",
        "reference_sequence": {
            "sequence": "CCACGCCGCATCGTCATCCACCGTGGGTCAACGGGGTTAGGCTTCAATATCGTCGGTGGAGAGGATGGTGAGGGAATCTTCATCTCATTCATTCTGGCGGGAGGACCGGCCGATTTAAGCGGAGAACTTCGCAAAGGTGACCAGATCCTTTCGGTGAATGGCGTAGATTTGCGCAACGCATCACACGAACAGGCGGCCATCGCATTAAAGAACGCCGGCCAGACCGTTACGATTATCGCGCAGTATAAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 309,
            "identifier": "P78352",
            "url": "http://purl.uniprot.org/uniprot/P78352",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000053-a-2",
        "type": "Protein coding"
    },
    {
        "name": "PTEN",
        "reference_sequence": {
            "sequence": "ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAAGTCTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P60484",
            "url": "http://purl.uniprot.org/uniprot/P60484",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000013-a-1",
        "type": "Protein coding"
    },
    {
        "name": "PTEN",
        "reference_sequence": {
            "sequence": "ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAAGTCTGA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P60484",
            "url": "http://purl.uniprot.org/uniprot/P60484",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000054-a-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-i-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-b-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-c-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-a-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-e-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-d-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-f-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-h-1",
        "type": "Protein coding"
    },
    {
        "name": "RAF",
        "reference_sequence": {
            "sequence": "TCTAAGACAAGCAACACTATCCGTGTTTTCTTGCCGAACAAGCAAAGAACAGTGGTCAATGTGCGAAATGGAATGAGCTTGCATGACTGCCTTATGAAAGCACTCAAGGTGAGGGGC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 51,
            "identifier": "P04049",
            "url": "http://purl.uniprot.org/uniprot/P04049",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000061-g-1",
        "type": "Protein coding"
    },
    {
        "name": "Ras",
        "reference_sequence": {
            "sequence": "ACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTGGCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCCTACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTGCGTGAGATCCGGCAGCAC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P01112",
            "url": "http://purl.uniprot.org/uniprot/P01112",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000057-b-1",
        "type": "Protein coding"
    },
    {
        "name": "Ras",
        "reference_sequence": {
            "sequence": "ACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTGGCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCCTACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTGCGTGAGATCCGGCAGCAC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P01112",
            "url": "http://purl.uniprot.org/uniprot/P01112",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000057-c-1",
        "type": "Protein coding"
    },
    {
        "name": "Ras",
        "reference_sequence": {
            "sequence": "ACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTGGCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCCTACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTGCGTGAGATCCGGCAGCAC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P01112",
            "url": "http://purl.uniprot.org/uniprot/P01112",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000057-a-1",
        "type": "Protein coding"
    },
    {
        "name": "Ras",
        "reference_sequence": {
            "sequence": "ACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGCTGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATTCCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCGCCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCCTGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGCAGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTGACCTGGCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCATCCCCTACATCGAGACCTCGGCCAAGACCCGGCAGGGAGTGGAGGATGCCTTCTACACGTTGGTGCGTGAGATCCGGCAGCAC",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P01112",
            "url": "http://purl.uniprot.org/uniprot/P01112",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000057-d-1",
        "type": "Protein coding"
    },
    {
        "name": "RET enhancer",
        "reference_sequence": {
            "sequence": "CAGAGGCACCAGGGTCAAAGCCAGTGGTGATGCCCTGGCCCCGTTGCCCCAGGCCAGGGCCAGTGAACAATGTAATCAGCTGGGGCAGACTCTACAGCCCTGCAGCCAAGGGGGCCAGTGACCCTTACATGGTCATCCACAGGCCACTTGGGTGGCCAGTCCTGTTCAGCCAGGCCTTGCCCTAGGAAAGAAATTAATTATAACCTAATTGGCAGTTTCCTTTGCATAGAAGCCGGAAGCAACTGCCAGTGAGGCTGGTGATTAACTCTGCAGCAGCTGGGAAATTGCAGTTGGGCAGGAGCGCCCATCATCCTGGCCAGGCCGCTGCAGCTGGTCTGGGTATGGAAGTGTGGGTGGTGGCCATCGTGCAGCTTAGGGCCTGGGCCCCTCAGAGCAGAAGGCTGGGTCTGTGTGCAGAAGGTAGCCTTGGGCTGCCAGGTCCCCCAGTGCCCAGTTGCGGACCTCCTTCTCCCAAACCTCAGCCATGCCTGGACCCCTTCCCCACTCACGGCAGAAGGCTGCATGGCTTTTAGGGGTGTCAGGAGGCTCATGTCCTGGTTGCAGTTCTACCATGGGTGTGCAGCGGGAATTCTGGGCTTC",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000028-a-1",
        "type": "Regulatory"
    },
    {
        "name": "S505N MPL",
        "reference_sequence": {
            "sequence": "ACCGAGACCGCCTGGATCTCCTTGGTGACCGCTCTGCATCTAGTGCTGGGCCTCAACGCCGTCCTGGGCCTGCTGCTGCTGAGGTGGCAGTTT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 486,
            "identifier": "P40238",
            "url": "http://purl.uniprot.org/uniprot/P40238",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg16",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.10",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.10",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000043-a-2",
        "type": "Protein coding"
    },
    {
        "name": "SARS-CoV-2 receptor binding domain",
        "reference_sequence": {
            "sequence": "AATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000044-a-2",
        "type": "Protein coding"
    },
    {
        "name": "SARS-CoV-2 receptor binding domain",
        "reference_sequence": {
            "sequence": "AATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000044-b-2",
        "type": "Protein coding"
    },
    {
        "name": "SARS-CoV-2 receptor binding domain",
        "reference_sequence": {
            "sequence": "AATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000044-b-1",
        "type": "Protein coding"
    },
    {
        "name": "SARS-CoV-2 receptor binding domain",
        "reference_sequence": {
            "sequence": "AATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "Other",
                    "organism_name": "Other - genome not listed",
                    "assembly_identifier": null
                }
            }
        ],
        "scoreset": "urn:mavedb:00000044-a-1",
        "type": "Protein coding"
    },
    {
        "name": "SORT1 enhancer",
        "reference_sequence": {
            "sequence": "GAACTGGAAAAGCCCTGTCCGGTGAGGGGGCAGAAGGACTCAGCGCCCCTGGACCCCCAAATGCTGCATGAACACATTTTCAGGGGAGCCTGTGCCCCCAGGCGGGGGTCGGGCAGCCCCAGCCCCTCTCCTTTTCCTGGACTCTGGCCGTGCGCGGCAGCCCAGGTGTTTGCTCAGTTGCTGACCCAAAAGTGCTTCATTTTTCGTGCCCGCCCCGCGCCCCGGGCAGGCCAGTCATGTGTTAAGTTGCGCTTCTTTGCTGTGATGTGGGTGGGGGAGGAAGAGTAAACACAGTGCTGGCTCGGCTGCCCTGAGGGTGCTCAATCAAGCACAGGTTTCAAGTCTGGGTTCTGGTGTCCACTCACCCACCCCACCCCCCAAAATCAGACAAATGCTACTTTGTCTAACCTGCTGTGGCCTCTGAGACATGTTCTATTTTTAACCCCTTCTTGGAATTGGCTCTCTTCTTCAAAGGACCAGGTCCTGTTCCTCTTTCTCCCCGACTCCACCCCAGCTCCCTGTGAAGAGAGAGTTAATATATTTGTTTTATTTATTTGCTTTTTGTGTTGGGATGGGTTCGTGTCCAGTCCCGGGGGTCTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000029-a-2",
        "type": "Regulatory"
    },
    {
        "name": "SORT1 enhancer",
        "reference_sequence": {
            "sequence": "GAACTGGAAAAGCCCTGTCCGGTGAGGGGGCAGAAGGACTCAGCGCCCCTGGACCCCCAAATGCTGCATGAACACATTTTCAGGGGAGCCTGTGCCCCCAGGCGGGGGTCGGGCAGCCCCAGCCCCTCTCCTTTTCCTGGACTCTGGCCGTGCGCGGCAGCCCAGGTGTTTGCTCAGTTGCTGACCCAAAAGTGCTTCATTTTTCGTGCCCGCCCCGCGCCCCGGGCAGGCCAGTCATGTGTTAAGTTGCGCTTCTTTGCTGTGATGTGGGTGGGGGAGGAAGAGTAAACACAGTGCTGGCTCGGCTGCCCTGAGGGTGCTCAATCAAGCACAGGTTTCAAGTCTGGGTTCTGGTGTCCACTCACCCACCCCACCCCCCAAAATCAGACAAATGCTACTTTGTCTAACCTGCTGTGGCCTCTGAGACATGTTCTATTTTTAACCCCTTCTTGGAATTGGCTCTCTTCTTCAAAGGACCAGGTCCTGTTCCTCTTTCTCCCCGACTCCACCCCAGCTCCCTGTGAAGAGAGAGTTAATATATTTGTTTTATTTATTTGCTTTTTGTGTTGGGATGGGTTCGTGTCCAGTCCCGGGGGTCTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000029-a-1",
        "type": "Regulatory"
    },
    {
        "name": "SORT1 enhancer (flipped)",
        "reference_sequence": {
            "sequence": "TGAACTGGAAAAGCCCTGTCCGGTGAGGGGGCAGAAGGACTCAGCGCCCCTGGACCCCCAAATGCTGCATGAACACATTTTCAGGGGAGCCTGTGCCCCCAGGCGGGGGTCGGGCAGCCCCAGCCCCTCTCCTTTTCCTGGACTCTGGCCGTGCGCGGCAGCCCAGGTGTTTGCTCAGTTGCTGACCCAAAAGTGCTTCATTTTTCGTGCCCGCCCCGCGCCCCGGGCAGGCCAGTCATGTGTTAAGTTGCGCTTCTTTGCTGTGATGTGGGTGGGGGAGGAAGAGTAAACACAGTGCTGGCTCGGCTGCCCTGAGGGTGCTCAATCAAGCACAGGTTTCAAGTCTGGGTTCTGGTGTCCACTCACCCACCCCACCCCCCAAAATCAGACAAATGCTACTTTGTCTAACCTGCTGTGGCCTCTGAGACATGTTCTATTTTTAACCCCTTCTTGGAATTGGCTCTCTTCTTCAAAGGACCAGGTCCTGTTCCTCTTTCTCCCCGACTCCACCCCAGCTCCCTGTGAAGAGAGAGTTAATATATTTGTTTTATTTATTTGCTTTTTGTGTTGGGATGGGTTCGTGTCCAGTCCCGGGGGTCTG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000029-b-1",
        "type": "Regulatory"
    },
    {
        "name": "Src catalytic domain",
        "reference_sequence": {
            "sequence": "CTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGCTTTGGCGAGGTGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTGAAGCCTGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTGAGGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTCACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTACCTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTGGAGCGGATGAACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAACCTGGTGTGCAAAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACGGCGCGGCAAGGTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGCCGCTTCACCATCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACAAAGGGACGGGTGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGGGGCTACCGGATGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAGTGCTGGCGGAAGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 269,
            "identifier": "P12931",
            "url": "http://purl.uniprot.org/uniprot/P12931",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000041-a-1",
        "type": "Protein coding"
    },
    {
        "name": "Src SH4 domain",
        "reference_sequence": {
            "sequence": "GGTAGCAACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P12931",
            "url": "http://purl.uniprot.org/uniprot/P12931",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000041-b-1",
        "type": "Protein coding"
    },
    {
        "name": "SUL1 promoter",
        "reference_sequence": {
            "sequence": "CGCCACCTCGAGTGCACTTTTTTTAATAAAGATCTCGTGTAATTGTCCAAATCTGACTTTTTCTTATAGTCTCGCTGGAACCACAGTGCGGCTTTGCAATTTTGCAAATCGGAATTTGAGTCACAGATCCCAGAAAAACTCCACACCTTCCCCACGCAGCAAGCGATAACGAACAAGTTGTCAAATTAGACCCATAATAATTTTGAACACTTCTACCTGTTCATGTCTTTTCTCGAACACTGTCATTTGAAATTATGCACTGTGAAAAAAAGAAACAAAGACCAAAAGAATAATATAAATAGTGAAGTAAAATGTGTTGTAATGCACATGGATCTTGTACTGCTCAAACTTAATATTTCTATTGTAGAAAAATTTTCGATTTAAAATTGTGAAACCGATTATATAAAAGTATATTAGCTGACATTAACGTCTCAAAACCAGGTCAATAGCTTTAAAAATAAAAATAAATCCCTGCAGAATACTCGGAAAGAAT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000009-a-2",
        "type": "Regulatory"
    },
    {
        "name": "SUL1 promoter",
        "reference_sequence": {
            "sequence": "CGCCACCTCGAGTGCACTTTTTTTAATAAAGATCTCGTGTAATTGTCCAAATCTGACTTTTTCTTATAGTCTCGCTGGAACCACAGTGCGGCTTTGCAATTTTGCAAATCGGAATTTGAGTCACAGATCCCAGAAAAACTCCACACCTTCCCCACGCAGCAAGCGATAACGAACAAGTTGTCAAATTAGACCCATAATAATTTTGAACACTTCTACCTGTTCATGTCTTTTCTCGAACACTGTCATTTGAAATTATGCACTGTGAAAAAAAGAAACAAAGACCAAAAGAATAATATAAATAGTGAAGTAAAATGTGTTGTAATGCACATGGATCTTGTACTGCTCAAACTTAATATTTCTATTGTAGAAAAATTTTCGATTTAAAATTGTGAAACCGATTATATAAAAGTATATTAGCTGACATTAACGTCTCAAAACCAGGTCAATAGCTTTAAAAATAAAAATAAATCCCTGCAGAATACTCGGAAAGAAT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000009-a-1",
        "type": "Regulatory"
    },
    {
        "name": "SUMO1",
        "reference_sequence": {
            "sequence": "ATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGAAGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCAAAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63165",
            "url": "http://purl.uniprot.org/uniprot/P63165",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000116030",
            "url": "http://www.ensembl.org/id/ENSG00000116030",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 149,
            "identifier": "NM_001005781.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001005781.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-b-2",
        "type": "Protein coding"
    },
    {
        "name": "SUMO1",
        "reference_sequence": {
            "sequence": "ATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGAAGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCAAAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63165",
            "url": "http://purl.uniprot.org/uniprot/P63165",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000116030",
            "url": "http://www.ensembl.org/id/ENSG00000116030",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 149,
            "identifier": "NM_001005781.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_001005781.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-b-1",
        "type": "Protein coding"
    },
    {
        "name": "TARDBP",
        "reference_sequence": {
            "sequence": "ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGATGGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGAAATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGATCTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAAGATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTGCGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 994,
            "identifier": "Q13148",
            "url": "http://purl.uniprot.org/uniprot/Q13148",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000120948",
            "url": "http://www.ensembl.org/id/ENSG00000120948",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 0,
            "identifier": "NP_031401.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_031401.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg19",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.13",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000060-a-2",
        "type": "Protein coding"
    },
    {
        "name": "TARDBP",
        "reference_sequence": {
            "sequence": "ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGATGGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGAAATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGATCTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAAGATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTGCGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 868,
            "identifier": "Q13148",
            "url": "http://purl.uniprot.org/uniprot/Q13148",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000120948",
            "url": "http://www.ensembl.org/id/ENSG00000120948",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 0,
            "identifier": "NP_031401.1",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NP_031401.1",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg19",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.13",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000060-a-1",
        "type": "Protein coding"
    },
    {
        "name": "TCF7L2 enhancer",
        "reference_sequence": {
            "sequence": "AGGTTCTGTTTCTTGCTTAGTCACTTTCTGTTTGAACAAAATTGGAATTTCCTTTTTGGATCTGTTTCTTTAATTGTAAATTGAATCGGACTAAAACCTTTCCAATTTTTTCACATGTGAAGACATACACAAAAGTTTTATTGGAGGGTTGCACATGTGAAAGAAAAAGGGAGAAAGCAGGATTGAGCAGGGGGAGCCGTCAGATGGTAATGCAGATGTGATGAGATCTCTGCCGGACCAAAGAGAAGATTCCTTTTTAAATGGTGACAAATTCATGGGCTTTCTCTGCCTCAAAACCTAGCACAGCTGTTATTTACTGAACAATTAGAGAGCTAAGCACTTTTTAGATACTATATAATTTAATTGCCGTATGAGGCACCCTTAGTTTTCAGACGAGAAACCACAGTTACAGGGAAGGCAAGTAACTTAGTCAATGTCAGATAACTAGGAAAAGGTTAGAGGGGCCCTGGACACAGGCCTGTGTGACTGAGAAGCTTGGGCACTTCACTGCTACATTTCATCTCTTCGCTATAAACATTTTAGCTTTTTGTGTTTGCTGACTGGCAACAATACATAGTGAAAGTTCTAATAATTTGTAAT",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000030-a-1",
        "type": "Regulatory"
    },
    {
        "name": "TERT promoter",
        "reference_sequence": {
            "sequence": "TCGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000031-a-1",
        "type": "Regulatory"
    },
    {
        "name": "TERT promoter",
        "reference_sequence": {
            "sequence": "TCGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000031-c-1",
        "type": "Regulatory"
    },
    {
        "name": "TERT promoter",
        "reference_sequence": {
            "sequence": "TCGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000031-b-1",
        "type": "Regulatory"
    },
    {
        "name": "TERT promoter",
        "reference_sequence": {
            "sequence": "TCGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGG",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000031-d-1",
        "type": "Regulatory"
    },
    {
        "name": "TPK1",
        "reference_sequence": {
            "sequence": "ATGGAGCATGCCTTTACCCCGTTGGAGCCCCTGCTTTCCACTGGGAATTTGAAGTACTGCCTTGTAATTCTTAATCAGCCTTTGGACAACTATTTTCGTCATCTTTGGAACAAAGCTCTTTTAAGAGCCTGTGCCGATGGAGGTGCCAACCGCTTATATGATATCACCGAAGGAGAGAGAGAAAGCTTTTTGCCTGAATTCATCAATGGAGACTTTGATTCTATTAGGCCTGAAGTCAGAGAATACTATGCTACTAAGGGATGTGAGCTCATTTCAACTCCTGATCAAGACCACACTGACTTTACTAAGTGCCTTAAAATGCTCCAAAAGAAGATAGAAGAAAAAGACTTAAAGGGAAAGCACAGGTTGCATGTAGACACTGGAATGGAGGGTGATTGGTGTGGCCTTATTCCTGTTGGACAGCCTTGTATGCAGGTTACAACCACAGGCCTCAAGTGGAACCTCACAAATGATGTGCTTGCTTTTGGAACATTGGTCAGTACTTCCAATACCTACGACGGGTCTGGTGTTGTGACTGTGGAAACTGACCACCCACTCCTCTGGACCATGGCCATCAAAAGCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "Q9H3S4",
            "url": "http://purl.uniprot.org/uniprot/Q9H3S4",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000196511",
            "url": "http://www.ensembl.org/id/ENSG00000196511",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 104,
            "identifier": "NM_022445.3",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_022445.3",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-d-2",
        "type": "Protein coding"
    },
    {
        "name": "TPK1",
        "reference_sequence": {
            "sequence": "ATGGAGCATGCCTTTACCCCGTTGGAGCCCCTGCTTTCCACTGGGAATTTGAAGTACTGCCTTGTAATTCTTAATCAGCCTTTGGACAACTATTTTCGTCATCTTTGGAACAAAGCTCTTTTAAGAGCCTGTGCCGATGGAGGTGCCAACCGCTTATATGATATCACCGAAGGAGAGAGAGAAAGCTTTTTGCCTGAATTCATCAATGGAGACTTTGATTCTATTAGGCCTGAAGTCAGAGAATACTATGCTACTAAGGGATGTGAGCTCATTTCAACTCCTGATCAAGACCACACTGACTTTACTAAGTGCCTTAAAATGCTCCAAAAGAAGATAGAAGAAAAAGACTTAAAGGGAAAGCACAGGTTGCATGTAGACACTGGAATGGAGGGTGATTGGTGTGGCCTTATTCCTGTTGGACAGCCTTGTATGCAGGTTACAACCACAGGCCTCAAGTGGAACCTCACAAATGATGTGCTTGCTTTTGGAACATTGGTCAGTACTTCCAATACCTACGACGGGTCTGGTGTTGTGACTGTGGAAACTGACCACCCACTCCTCTGGACCATGGCCATCAAAAGCTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "Q9H3S4",
            "url": "http://purl.uniprot.org/uniprot/Q9H3S4",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000196511",
            "url": "http://www.ensembl.org/id/ENSG00000196511",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 104,
            "identifier": "NM_022445.3",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_022445.3",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-d-1",
        "type": "Protein coding"
    },
    {
        "name": "TPMT",
        "reference_sequence": {
            "sequence": "ATGGATGGTACAAGAACTTCACTTGACATTGAAGAGTACTCGGATACTGAGGTACAGAAAAACCAAGTACTAACTCTGGAAGAATGGCAAGACAAGTGGGTGAACGGCAAGACTGCTTTTCATCAGGAACAAGGACATCAGCTATTAAAGAAGCATTTAGATACTTTCCTTAAAGGCAAGAGTGGACTGAGGGTATTTTTTCCTCTTTGCGGAAAAGCGGTTGAGATGAAATGGTTTGCAGACCGGGGACACAGTGTAGTTGGTGTGGAAATCAGTGAACTTGGGATACAAGAATTTTTTACAGAGCAGAATCTTTCTTACTCAGAAGAACCAATCACCGAAATTCCTGGAACCAAAGTATTTAAGAGTTCTTCGGGGAACATTTCATTGTACTGTTGCAGTATTTTTGATCTTCCCAGGACAAATATTGGCAAATTTGACATGATTTGGGATAGAGGAGCATTAGTTGCCATTAATCCAGGTGATCGCAAATGCTATGCAGATACAATGTTTTCCCTCCTGGGAAAGAAGTTTCAGTATCTCCTGTGTGTTCTTTCTTATGATCCAACTAAACATCCAGGTCCACCATTTTATGTTCCACATGCTGAAATTGAAAGGTTGTTTGGTAAAATATGCAATATACGTTGTCTTGAGAAGGTTGATGCTTTTGAAGAACGACATAAAAGTTGGGGAATTGACTGTCTTTTTGAAAAGTTATATCTACTTACAGAAAAGTAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P51580",
            "url": "http://purl.uniprot.org/uniprot/P51580",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000013-b-1",
        "type": "Protein coding"
    },
    {
        "name": "UBE2I",
        "reference_sequence": {
            "sequence": "ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTACGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCATTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGACAAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTAAATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAACAGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63279",
            "url": "http://purl.uniprot.org/uniprot/P63279",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000103275",
            "url": "http://www.ensembl.org/id/ENSG00000103275",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 159,
            "identifier": "NM_003345",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_003345",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-a-4",
        "type": "Protein coding"
    },
    {
        "name": "UBE2I",
        "reference_sequence": {
            "sequence": "ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTACGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCATTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGACAAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTAAATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAACAGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63279",
            "url": "http://purl.uniprot.org/uniprot/P63279",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000103275",
            "url": "http://www.ensembl.org/id/ENSG00000103275",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 159,
            "identifier": "NM_003345",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_003345",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-a-1",
        "type": "Protein coding"
    },
    {
        "name": "UBE2I",
        "reference_sequence": {
            "sequence": "ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTACGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCATTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGACAAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTAAATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAACAGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63279",
            "url": "http://purl.uniprot.org/uniprot/P63279",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000103275",
            "url": "http://www.ensembl.org/id/ENSG00000103275",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 159,
            "identifier": "NM_003345",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_003345",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-a-3",
        "type": "Protein coding"
    },
    {
        "name": "UBE2I",
        "reference_sequence": {
            "sequence": "ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTACGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCATTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGACAAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTAAATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAACAGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 0,
            "identifier": "P63279",
            "url": "http://purl.uniprot.org/uniprot/P63279",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": {
            "offset": 0,
            "identifier": "ENSG00000103275",
            "url": "http://www.ensembl.org/id/ENSG00000103275",
            "dbversion": null,
            "dbname": "Ensembl"
        },
        "refseq": {
            "offset": 159,
            "identifier": "NM_003345",
            "url": "http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NM_003345",
            "dbversion": null,
            "dbname": "RefSeq"
        },
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000001-a-2",
        "type": "Protein coding"
    },
    {
        "name": "Ubiquitin",
        "reference_sequence": {
            "sequence": "CAACAAAGATTGATCTTTGCTGGTAAG",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 39,
            "identifier": "P0CG63",
            "url": "http://purl.uniprot.org/uniprot/P0CG63",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000038-b-1",
        "type": "Protein coding"
    },
    {
        "name": "Ubiquitin",
        "reference_sequence": {
            "sequence": "CACTTGGTCTTGAGATTGAGAGGTGGT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 67,
            "identifier": "P0CG63",
            "url": "http://purl.uniprot.org/uniprot/P0CG63",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000038-b-2",
        "type": "Protein coding"
    },
    {
        "name": "Ubiquitin",
        "reference_sequence": {
            "sequence": "CAAATTTTCGTCAAGACTTTAACCGGTAAGACTATTACCCTGGAAGTTGAATCTTCTGACACTATTGACAATGTCAAGTCCAAGATCCAAGACAAGGAAGGTATTCCACCTGACCAACAAAGATTGATCTTTGCTGGTAAGCAATTGGAAGATGGTAGAACTTTGTCCGACTACAACATCCAAAAGGAATCTACTCTACACTTGGTCTTGAGATTGAGAGGTGGT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P0CG63",
            "url": "http://purl.uniprot.org/uniprot/P0CG63",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000037-a-1",
        "type": "Protein coding"
    },
    {
        "name": "Ubiquitin",
        "reference_sequence": {
            "sequence": "CAAATTTTCGTCAAGACTTTAACCGGTAAGACTATTACCCTGGAAGTTGAATCTTCTGACACTATTGACAATGTCAAGTCCAAGATCCAAGACAAGGAAGGTATTCCACCTGACCAACAAAGATTGATCTTTGCTGGTAAGCAATTGGAAGATGGTAGAACTTTGTCCGACTACAACATCCAAAAGGAATCTACTCTACACTTGGTCTTGAGATTGAGAGGTGGT",
            "sequence_type": "dna"
        },
        "uniprot": {
            "offset": 1,
            "identifier": "P0CG63",
            "url": "http://purl.uniprot.org/uniprot/P0CG63",
            "dbversion": null,
            "dbname": "UniProt"
        },
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "sacCer3/R64",
                    "organism_name": "Saccharomyces cerevisiae",
                    "assembly_identifier": {
                        "identifier": "GCF_000146045.2",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000146045.2",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000038-a-1",
        "type": "Protein coding"
    },
    {
        "name": "UC88 enhancer",
        "reference_sequence": {
            "sequence": "ATACAGATAAATGCACACATGTATACGCGAAAGGTTAACTCGGCGGAGGACTCGCCCAAATAAGCACCGGGATTGCATTTAAAATAATAATAATAAATAAATAAATAAACTAGGAAGGAAAGCGGGGGGAGGGAAGCAGAAGTCGGGAAGAAAAGAGAAAAGCAGCAGGCTGATTACGAGGTGTCAAAACTGCCAGGAGCAAGAAGGTGATAGCAATCAGGGGTGAGAAGAGTGCGGCATTCGTGCGGGGCAACTAATTATCCGTCTCATTTGAGAAGAGCAGCATTTGAGGCAGCAGCGTTCGCCTGCTGAACGGTGACAGATTGGCGCGGAGGAGAGGGGAGGTGTTAAAACAATGGAGCCGGGCGCGCGAGCGCTGCTGCATGCTAATCAGCCCTCCCTCCGCCTGCCTGCCGCGCTCCCTCCTTCCTCCCGGCCTCCCTCCTCCGCGCTCCCTCCTCCCGCCTGCGGCGCTCCCTCCTTTCCAGCGGGCCCCGCGCCGCCGCCGCCACCCGCTTCCTGCTCCCTCGCTTTCCCGCGCGTCCTTCCCGCCGCTGGCGAGTGGAACCCAGCCACCGCCACCGAGTCCCA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000032-a-1",
        "type": "Regulatory"
    },
    {
        "name": "ZFAND3 enhancer",
        "reference_sequence": {
            "sequence": "GTTCATGTTTCCCCCGTATGTGCGTGCGCATGCACATATATAAACACATCTAGCTTCACACCTGTGTACTCACACCTGTGTGTACACACTCCTCCTGTACATGTGTATACACGCACACCCTCCCACCAGCATGAGCAGTATGTGGATTTTTTCTTCCAGCAGCCCTTTCAAGAACATACACCAGATGGGATTGGGTCTGCTACATGACTGAGCAGCCCCCACATCAGAAAGTCATCATCATTGAATCCATCATGTGGTGCAGCCTTGGCAAGGGCACAGCTCCTCGTCCTGCCCAATGGGCCGTGGAGGAATGCCTCCTCCTCCAGAGCAGAGAGCAGATATGGGCAGGCAGTTGCCAGGCAGTTGAGCCGGGAGAACAGATGGCAGCTGCACAGCCTCCTTCTAGCCCAGTTTCCTGGCTGCCGGGGAAGGAGTTGCAGGCGGCAAGGATCCTGCAGAAACCGCCCTCCCTATAACAGGCCATCTTGCCCTCTATCCTCTTACTGGGCTTTGGAGGTCCCAATCCTGCCCTGGTTCACCACCTGTGTGGCTTACCAAGCTGTGCAACTTGGGGCAGGA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000033-a-1",
        "type": "Regulatory"
    },
    {
        "name": "ZRS enhancer",
        "reference_sequence": {
            "sequence": "TGAGATATGGCTTCATTTTCTGTAATAAACACTAAGATCAAAACATGACCCAAGTTAAATTTCCTTGCAGGGTTCCCAGCAGGGGCTTCCCTTTTGTCTGTGATTTCCTCTCACCCACCAGAACCAGGCCAAATATGCGCATGTGCCACTAACACTAAGCAGCACTTCCTTAATCACTCATTTCCAACAATTTATGGATCATCAGTGGCAAAAAACGAGCAAAAATAATGAAAGAATGCAATGAAAGCTCGTGGAGACAGAGGCTGGACTTCCTACTCACTCTGTGTCTCTTTAAGATGGAGGCCTGATACAAATTAGCCACTGGGGGGAAAAAGTCATCTGGTCATAAAATACAGTACAAGGTCACTTTTATGTAAGTTTGCCAAAAGGGACATAAACCAGGACAATTTCAAACTGTGACACAGGATAGAAACATATTAAAAAAATCTTTGTTCCTCCTCTATTGTGCTGTCATGTTGCTCAGCA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000034-a-1",
        "type": "Regulatory"
    },
    {
        "name": "ZRS enhancer",
        "reference_sequence": {
            "sequence": "TGAGATATGGCTTCATTTTCTGTAATAAACACTAAGATCAAAACATGACCCAAGTTAAATTTCCTTGCAGGGTTCCCAGCAGGGGCTTCCCTTTTGTCTGTGATTTCCTCTCACCCACCAGAACCAGGCCAAATATGCGCATGTGCCACTAACACTAAGCAGCACTTCCTTAATCACTCATTTCCAACAATTTATGGATCATCAGTGGCAAAAAACGAGCAAAAATAATGAAAGAATGCAATGAAAGCTCGTGGAGACAGAGGCTGGACTTCCTACTCACTCTGTGTCTCTTTAAGATGGAGGCCTGATACAAATTAGCCACTGGGGGGAAAAAGTCATCTGGTCATAAAATACAGTACAAGGTCACTTTTATGTAAGTTTGCCAAAAGGGACATAAACCAGGACAATTTCAAACTGTGACACAGGATAGAAACATATTAAAAAAATCTTTGTTCCTCCTCTATTGTGCTGTCATGTTGCTCAGCA",
            "sequence_type": "dna"
        },
        "uniprot": null,
        "ensembl": null,
        "refseq": null,
        "reference_maps": [
            {
                "genome": {
                    "short_name": "hg38",
                    "organism_name": "Homo sapiens",
                    "assembly_identifier": {
                        "identifier": "GCF_000001405.26",
                        "url": "http://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.26",
                        "dbversion": null,
                        "dbname": "GenomeAssembly"
                    }
                }
            }
        ],
        "scoreset": "urn:mavedb:00000034-b-1",
        "type": "Regulatory"
    }
]